Neural stem cell preparation used for cerebral infarction treatment and bimodally traceable by magnetic resonance and fluorescence imaging

A stem cell and host cell technology, applied in the fields of genetic engineering and biomedical engineering, can solve the problems of stem cell apoptosis, inaccurate stem cell treatment effect, low survival rate of stem cells, etc., to increase the number, improve anti-apoptosis and viability Effect

Inactive Publication Date: 2018-11-09
SUN YAT SEN UNIV
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Animal experiments have shown that NSCs transplantation in the treatment of cerebral infarction has a definite and obvious effect of promoting nerve function restoration, but the effect of stem cell therapy in preliminary clinical trials is not exact, and the effect of nerve function recovery in some patients is not significant
The most direct reason is that the microenvironment of stem cells induces a large number of stem cells to undergo apoptosis after transplantation, and the low survival rate of stem cells limits their ability to regenerate and repair.
In addition, tracing the stem cells transplanted into the body at the living level, and dynamically monitoring the survival, distribution, migration and fate of stem cells in vivo is an inevitable requirement for the clinical transformation of stem cell therapy, but there has been no breakthrough.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Neural stem cell preparation used for cerebral infarction treatment and bimodally traceable by magnetic resonance and fluorescence imaging
  • Neural stem cell preparation used for cerebral infarction treatment and bimodally traceable by magnetic resonance and fluorescence imaging
  • Neural stem cell preparation used for cerebral infarction treatment and bimodally traceable by magnetic resonance and fluorescence imaging

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1 Construction and Identification of FerritinH-T2A-Bcl2-EGFP Overexpression Lentiviral Vector

[0055] 1. Acquisition of the target gene

[0056] According to the gene sequence of rat FerritinH (NM_012848) and Bcl2 (NM_016993) in GenBank combined with the sequence of self-cleaving polypeptide T2A, the rat FerritinH-T2A-Bcl2 gene was synthesized by chemical synthesis. Design specific primers as follows:

[0057] FerritinH-T2A-Bcl2 upstream primer (SEQ ID NO: 1): FerritinH+Bcl2-P1

[0058] GAGGATCCCCGGGTACCGGTCGCCACCATGACCACCGCGTCTCCCTC

[0059] FerritinH-T2A-Bcl2 downstream primer (SEQ ID NO: 2): FerritinH+Bcl2-P2

[0060] TCACCATGGTGGCGACCGGCTTGTGGCCCAGGTATGCAC

[0061] Primers were used to amplify the FerritinH-T2A-IFNβ sequence by PCR. After the PCR product was electrophoresed on the agarose gel, the target band with a molecular weight of about 1Kb was excised for later use.

[0062] 2. Construction and sequencing of recombinant plasmids

[0063] The re...

Embodiment 2

[0070] Example 2 Determination of Optimal Transfection Conditions for NSCs by FerritinH-T2A-Bcl2-EGFP Overexpression Lentivirus

[0071] 1. Isolation and culture of NSCs

[0072] Neonatal 1-day-old SD rats were killed by necking, and the tissues around the bilateral lateral ventricles were separated under aseptic conditions, the brain tissue was cut into pieces, filtered, centrifuged, and the supernatant was discarded, resuspended and inoculated to 25 cm 2 In culture flask, 37°C, 5% CO 2 1. Cultivate under saturated humidity until neurospheres are formed. When the light transmittance of neurospheres is significantly reduced, subculture at 1:2.

[0073] 2. Determination of optimal transfection conditions for NSCs by FerritinH-T2A-Bcl2-EGFP overexpression lentivirus

[0074] Press 1×10 5 NSCs cells / well were planted in a 12-well culture plate, and 1 mL of complete medium was added to each well. When the cell confluency was about 50%, the culture medium was removed, washed wi...

Embodiment 3

[0076] Example 3 In vitro effectiveness detection of FerritinH-T2A-Bcl2-EGFP overexpression lentivirus transfected NSCs

[0077] 1. Fluorescent expression rate of FTH-Bcl2-EGFP-NSCs detected by flow cytometry

[0078] NSCs by 2×10 5 Cells / well were seeded in a 6-well plate, and lentiviral transfection was performed according to the optimal transfection conditions above. After 24 hours, the virus-containing culture medium was removed, the culture medium was removed, washed with PBS, digested with trypsin, blown into a cell suspension, and counted. Take 5×10 5 After each FTH-Bcl2-NSCs, the expression rate of eGFP in transfected cells was detected by flow cytometry.

[0079] The results show that the fluorescence expression of EGFP measured by flow cytometry is shown in Figure 4 , the expression rate of EGFP was stable at about 78.62±0.29% after transfection.

[0080] 2. Real-time PCR detection of FerritinH, Bcl2 mRNA levels of NSCs after transfection

[0081] NSCs by 2×10...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Titeraaaaaaaaaa
Login to View More

Abstract

The invention constructs a FerritinH-T2A-Bcl2-EGFP-containing over-expressed lentivirus vector by utilizing a fusion gene with a nucleotide sequence as shown in SEQ ID NO: 3. The FerritinH-T2A-Bcl2-EGFP-containing overexpressed lentivirus vector can safely and efficiently perform three-gene combined modification on NSCs. Through overexpression of Bcl2 by modified stem cells, the anti-apoptosis andsurvival abilities of transplanted NSCs are enhanced; the number of effective survival stem cells is increased; and the treatment effect of cerebral infarction is improved. Through imaging of FerritinH and EGFP reporter genes, bimodal tracing of magnetic resonance and fluorescence imaging is performed on NSCs at a living level; and real-time, dynamic, non-invasive and systematic monitoring of transplanted NSCs is realized. Thus, an experimental basis is provided for promoting clinical transformation of stem cell treatment; a novel means is provided for further expounding of the mechanism of neural stem cell action; and important scientific significance and clinical application prospects in stem-cell substitutive treatment or transgenosis treatment of neurological lesions are achieved.

Description

technical field [0001] The present invention relates to the technical fields of genetic engineering and biomedical engineering, and more specifically, relates to a neural stem cell preparation that can be used for the treatment of cerebral infarction and can be dual-modally traced by magnetic resonance and fluorescence imaging. Background technique [0002] Cerebral infarction, also known as ischemic stroke, is called stroke or stroke in traditional Chinese medicine. The disease is caused by various causes of blood supply disturbance in the local brain tissue area, resulting in ischemic and hypoxic lesions and necrosis of the brain tissue, resulting in clinically corresponding neurological deficits. According to different pathogenesis, cerebral infarction is divided into main types such as cerebral thrombosis, cerebral embolism and lacunar infarction. Among them, cerebral thrombosis is the most common type of cerebral infarction, accounting for about 60% of all cerebral inf...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/62C07K19/00C12N15/867C12N7/01C12N5/10A61K49/00A61K49/14A61K48/00A61K38/16A61P9/10
CPCA61K38/16A61K48/0025A61K48/005A61K49/0047A61K49/14A61P9/10C12N5/0636C12N7/00C12N15/86C12N2510/00C12N2740/15021C12N2740/15043
Inventor沈君张芳毛家骥
OwnerSUN YAT SEN UNIV