Method for constructing recombinant bacteria capable of efficiently secreting and expressing bacterial heparin hydrolase

A construction method, the technology of bacterial heparin, applied in the field of enzyme engineering, can solve the problems of intracellular expression not achieving high-efficiency secretion expression, yield not reported, etc., and achieve the effect of simple method, easy scale-up culture, and low nutritional requirements

Inactive Publication Date: 2018-11-20
JIANGNAN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The current method of producing heparin hydrolase is BL21, the yield has not been reported, and the existing problem is that the intracellular expression has not achieved efficient secretory expression

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing recombinant bacteria capable of efficiently secreting and expressing bacterial heparin hydrolase
  • Method for constructing recombinant bacteria capable of efficiently secreting and expressing bacterial heparin hydrolase
  • Method for constructing recombinant bacteria capable of efficiently secreting and expressing bacterial heparin hydrolase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1: Construction of recombinant Pichia pastoris producing heparan hydrolase

[0024] Construction of a genetically engineered bacterium producing heparan hydrolase:

[0025] Using pPIC9K as a vector, the heparin hydrolase gene (nucleotide sequence shown in SEQ ID NO: 1) was cloned, and a 6-his tag was added after the gene ATG. Such as figure 1 As shown, the upstream primer introduces the EcoR I restriction enzyme site; the downstream primer introduces the Not I restriction enzyme site; after gene Hepa and plasmid pPIC9K are digested and purified by restriction endonuclease EcoR I and Not I, 16°C Overnight ligation was transferred into Escherichia coli JM109 for amplification, and the plasmids with correct sequencing were selected and transferred into Pichiapastoris GS115 for expression to obtain recombinant Pichia pastoris GS115 / pPIC9K-BpHEP containing the recombinant heparin hydrolase gene.

[0026] The upstream and downstream primers are:

[0027] F: GAATTCA...

Embodiment 2

[0029] Example 2: Construction of Escherichia coli recombinant bacteria producing heparan hydrolase

[0030] Construction of a genetically engineered bacterium producing heparan hydrolase:

[0031] Using pET20 as a vector, the heparin hydrolase gene was cloned. Such as figure 2 As shown, the upstream primer introduces the EcoR I restriction enzyme site; the downstream primer introduces the Not I restriction enzyme site; after gene Hepa and plasmid pET20 are digested and purified by restriction endonuclease EcoR I and Not I, 16°C Overnight ligation was transferred into Escherichia coli JM109 for amplification, and the plasmids with correct sequencing were selected and transferred into BL21 for expression to obtain recombinant Escherichia coli BL21DE3 / PET20-BpHEP containing the recombinant heparin hydrolase gene.

[0032] The upstream and downstream primers are:

[0033] F: GAATTCATGCCGCAGCAGCCGCCG (SEQ ID NO: 3)

[0034] R: GCGGCCGCTTACAATTGAATAGATT (SEQ ID NO: 4)

Embodiment 3

[0035] Embodiment 3: Shake flask horizontal fermentation produces heparin hydrolase

[0036]The recombinant Escherichia coli BL21DE3 / PET20-BpHEP containing the recombinant heparin hydrolase gene was used as the production strain, and a single colony was inoculated in LB medium, and cultivated overnight at 37°C and 220rmp to obtain the seed culture solution; Inoculate 1% of the inoculum into 25mL of TB medium, wait until OD 600 When it grows to 0.6, add 0.1MIPTG to the medium, induce the expression at 28°C, and induce expression for 28h. After the fermentation, the heparinase activity was determined to be 10 U / mL.

[0037] The recombinant Pichia pastoris GS115 / pPIC9K-BpHEP containing the recombinant heparin hydrolase gene was used as the production strain, and a single colony was inoculated in YPD medium, and cultured overnight at 28°C and 200rmp to obtain the seed culture solution; the seed culture solution Inoculate 25 mL of BMGY medium with an inoculation amount of 2% by m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for constructing recombinant bacteria capable of efficiently secreting and expressing bacterial heparin hydrolase, and belongs to the technical field of enzyme engineering. The invention adopts a pichia pastoris expression system to construct a method for expressing heparin hydrolase. The secretion and expression of the heparin hydrolase are realized in the pichiapastoris expression system. The method is a method for producing heparin hydrolase by fermentation and plays an important role in promoting the industrial production of heparin hydrolase.

Description

technical field [0001] The invention relates to a method for constructing a recombinant bacterium for efficiently secreting and expressing bacterial heparin hydrolase, and belongs to the technical field of enzyme engineering. Background technique [0002] As a high molecular carbohydrate, polysaccharides widely exist in animals, plants and microorganisms, and have various biological activities such as anti-tumor, anti-virus, anti-oxidation, and immune regulation. Polysaccharides are mainly composed of disaccharide units, which are divided into heparan sulfate, heparin, hyaluronic acid, chondroitin sulfate, and dermatan sulfate. Polysaccharide lyase mainly cleaves heparin or heparan sulfate in the way of β elimination, mainly derived from Flavobacterium heparin, from which three heparinases are currently isolated and purified: heparinase I, II, III, used in the preparation of low molecular weight heparin and heparin The field of molecular structure analysis of polysaccharide...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/19C12N9/42C12N15/81C12R1/84
CPCC12N9/2434C12N15/815
Inventor康振陈坚原攀红堵国成
OwnerJIANGNAN UNIV