Application and expression vectors of paddy rice stomata open type potassium ion channel gene OsK2-1

A potassium ion channel, open-type technology, applied in the field of plant genetic engineering, can solve problems such as unseen, mismatched production mode, and metabolic imbalance.

Active Publication Date: 2018-12-25
INST OF SOIL SCI CHINESE ACAD OF SCI
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Existing studies on the improvement of nitrogen nutritional shape in rice by overexpressing ammonium uptake assimilation or response genes by means of molecular regulation, overexpressing the rice ammonium uptake system OsAMT1; 4 + (much lower than the actual farmland ammonium level) showed some positive effects, at higher ammonium (3mM NH 4 + ) under the condition of rice growth inhibition phenomenon (Ranathunge et al., 2014); regulation of another rice ammonium uptake system OsAMT1; Rice plants expressing ammonium assimilation genes such as OsGS1;1,1;2 and glnA all had reduced yield (Cai et al., 2009)
Overexpression of the nitrogen metabolism regulatory gene Dof1, a transcription factor derived from maize, can improve the nitrogen use efficiency of rice, but this positive effect only appears under low nitrogen conditions (Kurai et al., 2011)
Some other transcription factors found in recent years, such as HAP3, 14-3-3 protein, qNGR9, MiRNA, and kinases CIPK8 and CIPK23 are involved in the regulation of nitrogen uptake metabolism, but it has not been seen that these genes are involved in improving nitrogen use efficiency in rice. Applications
And the effective genes found in the application are all effective under the condition of low nitrogen supply, which does not match the current highly intensive production mode in my country

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application and expression vectors of paddy rice stomata open type potassium ion channel gene OsK2-1
  • Application and expression vectors of paddy rice stomata open type potassium ion channel gene OsK2-1
  • Application and expression vectors of paddy rice stomata open type potassium ion channel gene OsK2-1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 Cloning and bioinformatics analysis of rice OsK2-1 gene

[0028]The total RNA of Nipponbare rice grown in hydroponic culture for 10 days was extracted and used as a template and reverse-transcribed with Oligo(dT)18 as a primer to obtain cDNA of the reverse-transcribed product. According to the full-length coding sequence of rice OsK2-1, design primers to amplify the complete coding reading frame, and design two pairs of primers as required, one pair is upstream primer F1 and downstream primer R1 (forpTracer-CMV3), and the other pair is upstream Primer F2 and downstream primer R2 (for pUN1301), and introduce different enzyme cutting sites on each primer, as follows:

[0029] F1 (NotI, SEQ ID NO.3):

[0030] GTC GCGGCCGC ATGACCCAAGCTCACTCAAAATCTTGCTTC (for pTracer-CMV3);

[0031] R1 (NotI, SEQ ID NO.4):

[0032] GTC GCGGCCGC TACATCTCAAGAAGGAATAGATGGTCGCCATC (for pTracer-CMV3);

[0033] F2(BamHI, SEQ ID NO.5):

[0034] GTC GGATCC ATGACCCAAGCTCACTCAAAAT...

Embodiment 2

[0039] Example 2: Tissue specificity of rice OsK2-1 gene expression

[0040] 1. Spatiotemporal expression pattern of rice OsK2-1 gene

[0041] In order to understand the expression of OsK2-1 gene in different tissues and organs of rice, rice seedlings with consistent germination and growth were cultured in Kimura nutrient solution (see literature: Li SM et al., 2006) for 7 days and then treated with different concentrations of potassium. The processing is respectively:

[0042] Control group: complete Kimura nutrient solution (2mM KCl);

[0043] K-deficiency group: 0mM KCl (2mM NaCl instead);

[0044] High K group: 20mM KCl;

[0045] Change the nutrient solution every day, take samples from the roots and shoots after two days of treatment, freeze them in liquid nitrogen, extract the total RNA of rice roots and shoots, and use Oligo(dT)18 as a primer for reverse transcription (the operation steps are as follows: Kit instructions (AMV) to obtain reverse transcription product...

Embodiment 3

[0057] Example 3: Construction of recombinant plasmids pTracer-CMV3-OsK2-1 and pUN1301-OsK2-1

[0058] The rice OsK2-1 gene was constructed on pTracer-CMV3 through the restriction site NotI / NotI through the restriction site, and after the transformation of Escherichia coli competent cell DH5α, the plasmid was extracted and digested (Figure 3A) for identification (Kanwar, et al., 1980), the results showed that the recombinant plasmid pTracer-CMV3-OsK2-1 had been successfully obtained.

[0059] The rice OsK2-1 gene was constructed into pUN1301 via the restriction site BamHI / SacI, and after transformation into Escherichia coli competent cell DH5α, the plasmid was extracted and digested ( image 3 B) Identification. The results showed that the recombinant plasmid pUN1301-OsK2-1 had been successfully obtained.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to application and expression vectors of a paddy rice stomata open type potassium ion channel gene OsK2-1. The paddy rice stomata open type potassium ion channel gene OsK2-1 is obtained through cloning. The gene is mainly expressed in paddy rice overground part mesophyll and stomatal guard cells, and the gene protein has transport activity for mediating potassium ion inward absorption. The invention discovers the application of the paddy rice stomata open type potassium ion channel gene OsK2-1 in the increasing of crop photosynthetic rate, stomatal conductance and transpiration rate and in the increasing of nitrogen utilization efficiency in crop high-nitrogen environments for the first time. The animal expression vector and the plane overexpression vector of the paddy rice stomata open type potassium ion channel gene OsK2-1 evidently increase the biomass and grain yield of paddy rice modified by the OsK2-1 gene and especially has a good yield increasing effect and promising application prospect under a high-nitrogen condition.

Description

technical field [0001] The invention relates to the technical field of plant genetic engineering, in particular to the application of a rice stomatal open type potassium ion channel protein gene Osk2-1. Background technique [0002] Potassium is a key mineral nutrient element necessary for the growth and development of crops. It not only has the functions of improving the activity of enzyme systems in plants, promoting plant metabolism, material transportation in vivo and protein synthesis, but also can enhance plant photosynthesis and plant stress resistance. sex. Potassium uptake by plants is primarily mediated by various classes of potassium transporters and potassium channels (Epstein et al., 1963). The main feature of the transporter is that it combines with the transported ion and realizes transmembrane transport through a series of conformational changes. So far, three families of potassium transporters have been found in plants, namely KUP / HAK / KT family, TRK / HKT f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C12N15/82C12N15/85A01H5/00A01H6/46
CPCC07K14/415C12N15/8243C12N15/8269C12N15/85
Inventor苏彦华杨顺瑛
OwnerINST OF SOIL SCI CHINESE ACAD OF SCI