Application and expression vectors of paddy rice stomata open type potassium ion channel gene OsK2-1
A potassium ion channel, open-type technology, applied in the field of plant genetic engineering, can solve problems such as unseen, mismatched production mode, and metabolic imbalance.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1 Cloning and bioinformatics analysis of rice OsK2-1 gene
[0028]The total RNA of Nipponbare rice grown in hydroponic culture for 10 days was extracted and used as a template and reverse-transcribed with Oligo(dT)18 as a primer to obtain cDNA of the reverse-transcribed product. According to the full-length coding sequence of rice OsK2-1, design primers to amplify the complete coding reading frame, and design two pairs of primers as required, one pair is upstream primer F1 and downstream primer R1 (forpTracer-CMV3), and the other pair is upstream Primer F2 and downstream primer R2 (for pUN1301), and introduce different enzyme cutting sites on each primer, as follows:
[0029] F1 (NotI, SEQ ID NO.3):
[0030] GTC GCGGCCGC ATGACCCAAGCTCACTCAAAATCTTGCTTC (for pTracer-CMV3);
[0031] R1 (NotI, SEQ ID NO.4):
[0032] GTC GCGGCCGC TACATCTCAAGAAGGAATAGATGGTCGCCATC (for pTracer-CMV3);
[0033] F2(BamHI, SEQ ID NO.5):
[0034] GTC GGATCC ATGACCCAAGCTCACTCAAAAT...
Embodiment 2
[0039] Example 2: Tissue specificity of rice OsK2-1 gene expression
[0040] 1. Spatiotemporal expression pattern of rice OsK2-1 gene
[0041] In order to understand the expression of OsK2-1 gene in different tissues and organs of rice, rice seedlings with consistent germination and growth were cultured in Kimura nutrient solution (see literature: Li SM et al., 2006) for 7 days and then treated with different concentrations of potassium. The processing is respectively:
[0042] Control group: complete Kimura nutrient solution (2mM KCl);
[0043] K-deficiency group: 0mM KCl (2mM NaCl instead);
[0044] High K group: 20mM KCl;
[0045] Change the nutrient solution every day, take samples from the roots and shoots after two days of treatment, freeze them in liquid nitrogen, extract the total RNA of rice roots and shoots, and use Oligo(dT)18 as a primer for reverse transcription (the operation steps are as follows: Kit instructions (AMV) to obtain reverse transcription product...
Embodiment 3
[0057] Example 3: Construction of recombinant plasmids pTracer-CMV3-OsK2-1 and pUN1301-OsK2-1
[0058] The rice OsK2-1 gene was constructed on pTracer-CMV3 through the restriction site NotI / NotI through the restriction site, and after the transformation of Escherichia coli competent cell DH5α, the plasmid was extracted and digested (Figure 3A) for identification (Kanwar, et al., 1980), the results showed that the recombinant plasmid pTracer-CMV3-OsK2-1 had been successfully obtained.
[0059] The rice OsK2-1 gene was constructed into pUN1301 via the restriction site BamHI / SacI, and after transformation into Escherichia coli competent cell DH5α, the plasmid was extracted and digested ( image 3 B) Identification. The results showed that the recombinant plasmid pUN1301-OsK2-1 had been successfully obtained.
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com