Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cloning method and application of tobacco arsenic transportation gene NtNIP7-1

A technology of gene transfer and cloning method, applied in the field of genetic engineering, can solve the problem that the function of tobacco has not been reported yet, and achieve the effects of huge economic benefit potential, reduced arsenic content, and broad application prospects.

Active Publication Date: 2019-03-08
YUNNAN ACAD OF TOBACCO AGRI SCI
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

NIP7-1 Gene has previously functioned for arsenic uptake in other species, but its function in tobacco has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cloning method and application of tobacco arsenic transportation gene NtNIP7-1
  • Cloning method and application of tobacco arsenic transportation gene NtNIP7-1
  • Cloning method and application of tobacco arsenic transportation gene NtNIP7-1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] clone NtNIP7-1 Gene

[0047] Tobacco leaf cDNA was used as a template, and primers were designed according to the tobacco genome database information, and the NtNIP7-1 The PCR amplification of the gene was carried out to obtain the PCR amplification product, and the designed primers were as follows:

[0048] Forward primer: 5'- ATGGCTAAAGATCAATTGCAAGTGC -3';

[0049] Reverse primer: 5'-TTAAACTGGAATTGTTTGTGCATTAT -3';

[0050] The PCR reaction system and amplification conditions are as follows:

[0051]

[0052] The amplified PCR product was electrophoresed on a 0.8% agarose gel, and the gel electrophoresis results were as follows: figure 1 As shown, after electrophoresis, the PCR product purification kit from Qiagen was used to recover and purify the PCR product according to the product instructions, and sent to Invitrogen for sequencing to verify the sequence results.

Embodiment 2

[0054] Construction of Plant RNAi Vectors

[0055] In Example 1 NtNIP7-1 The full-length fragment is used as a template, and the primers containing the gateway adapter sequence are used for PCR amplification. After the PCR product is purified, the amplified product is inserted into the pdonr-zeo vector of Invitrogen Company through BP reaction (see figure 2 ), the good BP reaction carrier of the building block will be NtNIP7-1 Fragment replacement into PHellsgate12 RNAi vector (see image 3 )middle.

[0056] (1) The gateway reaction primer sequence is as follows:

[0057] NtNIP7-1 _F

[0058] 5'- GGGGACAAGTTTGTACAAAAAAAGCAGGCTGCtcacgaaaatgcaccaaaaccagg-3';

[0059] NtNIP7-1 _R

[0060] 5'- GGGGACCACTTTGTACAAGAAAGCTGGGTCgataaagggtaatcgccaccaatacc -3'

[0061] (2) PCR reactions were performed using Phusion high-fidelity polymerase for PCR cloning.

[0062] The PCR reaction system and conditions were the same as in Example 1.

[0063] (3) BP response:

[0064] (a) Pr...

Embodiment 3

[0079] Agrobacterium-mediated transformation of tobacco and identification of transgenic plants

[0080] (1) Transformation of Agrobacterium by freeze-thaw method

[0081] Add 1 μg (200 ng / μL) pHellsgate12 recombinant vector to 100 μL competent Agrobacterium LBA4404, mix well, let stand on ice for 5 min, freeze in liquid nitrogen for 5 min, and then take it out from the liquid nitrogen. Place in a water bath at 37°C for 5 minutes, then let stand on ice for 5 minutes, add 500 μL LB solution, resume cultivation at 28°C for 4 hours under sufficient shaking conditions, and finally spread the bacterial solution evenly on the selective plate culture medium at 28°C for 48 h.

[0082] (2) Tobacco variety Yunyan 87 was transformed by leaf disc method.

[0083] The specific method is as follows:

[0084] (a) Under aseptic conditions, put the tobacco Yunyan 87 seeds into the EP tube and rinse them with sterile water for 2-3 times;

[0085] (b) Soak in 75% alcohol for 30-60 s;

[008...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a tobacco arsenic transportation gene NtNIP7-1, and a cloning method and an application of the gene NtNIP7-1. A nucleotide sequence of the tobacco arsenic transportation gene NtNIP7-1 is shown as SEQ ID (sequence identifier): No. (number) 1, and an encoded amino acid sequence is shown as SEQ ID: No. 2. The invention further discloses the cloning method of the tobacco arsenic transportation gene NtNIP7-1. The cloning method particularly comprises the steps of: extracting tobacco RNA (ribonucleic acid) for reverse transcription to form first chain cDNA (complementary deoxyribonucleic acid), taking first chain cDNA obtained by the reverse transcription as a template, designing and synthesizing a specific primer according to an NtNIP7-1 gene sequence, performing PCR (polymerase chain reaction) amplification, recovering and purifying a PCR amplification product, and performing sequencing. An arsenic content of a tobacco leaf can be reduced obviously by inhibiting expression of the tobacco endogenous gene NtNIP7-1 in a tobacco plant, and the gene NtNIP7-1 has wide application prospects in the field of low arsenic content seed breeding of plants and a great economic benefit potential.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, in particular to a tobacco arsenic transport gene NtNIP7-1 Cloning methods and applications. Background technique [0002] Arsenic exists widely in nature and is one of the most abundant elements in the earth's crust, with an average concentration close to 3mg kg -1 (Cullen and Reimer, 1989). Usually, arsenic is released into the environment through natural reactions and anthropogenic actions, such as volcanic discharge, rock weathering, hot spring release, mining, smelting, and the use of arsenic-containing pesticides, herbicides, wood preservatives, and feed additives, etc. (Zhao et al. al., 2010b). At present, arsenic pollution has become a global problem, mainly involving food, air, water and soil pollution. Inorganic arsenic is a first-class human carcinogen, and water and food are the main sources of arsenic pollution (Smith et al., 2002; Tsuji et al., 2007). Reports show t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/10C12N15/82A01H5/00A01H6/82
CPCC12N15/8261C07K14/415C12N15/8218C12N15/8243
Inventor 白戈杨大海逄涛谢贺李勇姚恒李永平陈学军肖炳光方敦煌王亚辉杨春江张晨东吴兴富曾建敏
Owner YUNNAN ACAD OF TOBACCO AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com