Unlock instant, AI-driven research and patent intelligence for your innovation.

A method for precise regulation of gene expression in Corynebacterium glutamicum

A Corynebacterium glutamicum and gene expression technology, applied in the field of synthetic biology, can solve problems such as low standardization and poor single regulation effect, and achieve the effects of increasing production, preventing metabolic burden, and precise regulation

Active Publication Date: 2021-03-30
JIANGNAN UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] In order to overcome the problems of low degree of standardization of promoter and RBS and poor single regulation effect existing in the prior art, the present invention provides a method for precise regulation of gene expression by combining a standardized promoter and RBS, which significantly expands the The intensity of expression regulation, and eliminates the need for screening, greatly reducing the transformation cycle

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for precise regulation of gene expression in Corynebacterium glutamicum
  • A method for precise regulation of gene expression in Corynebacterium glutamicum
  • A method for precise regulation of gene expression in Corynebacterium glutamicum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Obtaining the promoter sequence and characterizing its strength includes the following steps:

[0031] On the basis of the inventor's previous research, on the basis of the endogenous promoter sequence of Corynebacterium glutamicum, according to the core site and base sequence characteristics of the Corynebacterium glutamicum promoter, by extending -10 respectively The rational transformation of the bases in the conserved sequence tgngnTA(c / t)aaTgg and the conserved sequence ttGnca in the -35 region yielded a series of strong promoter sequences. The promoter sequence of the present invention is as follows (SEQ ID NO.1-5) :

[0032] P1: CCGGAATTGACAGCTGGGGCGCCCTCAGAGGCACAATGGCCCTGCAA

[0033] P2: TGAGCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATT

[0034] P3: TGAGCTGTTGACAATTAATCATCGTGTGGTACCATGTGTGTGCTTGTGAGCGGATAACAATT

[0035] P4: TGAGCTGTTGCCAATTAATCATCGTGTGGTACCATGTGTGGAATTGTGAGCGGATAACAATT

[0036] P5: TGAGCTGTTGACAATTAATCATCGTGTGGTATAATTGAATTGTGAGC...

Embodiment 2

[0039] Obtaining the RBS sequence and characterizing its intensity includes the following steps:

[0040]According to the inventor's previous research work, according to the secondary structure characteristics of RBS and the core conservative sequence characteristics, several RBS sequences with different strengths were obtained, and then after sequence optimization and redundant fragment deletion, only the core minimal RBS sequence was retained, which is convenient for artificial synthesis , the five RBS sequences of the present invention are as follows (SEQ ID NO.6-10):

[0041] R1: CGAATTCGTAAAGTCCAAGAAAGCATTTCAAAAAGG

[0042] R2: CAAGTCAGTTAAGTACTAACAACTTAGAACTTT

[0043] R3: GATTAAGGCACAACGCATAAGGGGGGAGGCAAAG

[0044] R4: ACACTAGAAAGCGAAGGAGGTAAAAA

[0045] R5: TAATAACTACCAATAAAAGGAGGTACGAG

[0046] Add BsaI enzyme cutting sites before and after the above RBS sequence, and synthesize reverse complementary strands, use oligonucleotide annealing method to obtain RBS doub...

Embodiment 3

[0048] Construct the expression vector for the combination of promoter and RBS and characterize its combination strength, including the following steps:

[0049] Insert the RBS sequence into the recombinant expression vector pDXW-13-ΔBsaI-A16-1 of the above promoter, then transform the vector into E. The recombinant expression plasmids combined with the promoter and RBS were transformed into Corynebacterium glutamicum ATCC 14067 competent cells, and the recombinant expression strains with the combined use of the promoter and RBS were obtained by screening, and the recombinant expression plasmids with the combined use of the promoter and RBS were expanded to culture The strength of the combination of the promoter and RBS was characterized, and the combined strength of the combination of the promoter and RBS was characterized by quantitatively detecting the fluorescence intensity of the fluorescent protein expressed by the reporter gene eGFP, as shown in Table 1.

[0050] It can...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for accurately regulating corynebacterium glutamicum gene expression and belongs to the technical field of synthetic biology. By virtue of a standard simplest promoterand RBS (Ribosomal Binding Site) library, modification aiming at regulation of target gene expression is greatly reduced, the screening and intensity characterization link of an endogenous promoter or the RBS is saved, and the mean modification cycle of a target gene can be shortened from the previous 30-40 days to 10 days or less. The intensity span of the regulation method in the invention is more than 100 times higher than that of a single cell, so that extensive regulation of metabolic pathways and functional optimization of a biological system can be realized. Compared with the previousbroad-brush method for up-regulating or down-regulating the gene expression, the combine regulation method by utilizing standard cells in the invention has the advantage that the target genes can be accurately and quantitatively regulated. Therefore, the metabolic pathway is accurately regulated, particularly flow at the branch point is regulated, the yield of the target product can be improved, and metabolic burdens brought to cells due to over-expression of some genes can be avoided.

Description

technical field [0001] The invention relates to a method for precisely regulating the gene expression of Corynebacterium glutamicum, belonging to the technical field of synthetic biology. Background technique [0002] Corynebacterium glutamicum is a Gram-positive bacterium widely distributed in the biological world, and is widely used in the fermentation and production of amino acids needed by humans, such as glutamic acid, arginine, citrulline, ornithine, Serine, Isoleucine, Threonine, Phenylalanine, Lysine, Methionine, etc. [0003] At present, metabolic engineering transformation is the main means to improve the production traits of important industrial microbial strains represented by Escherichia coli, Corynebacterium glutamicum, and Bacillus subtilis, that is, to apply genetic engineering technology to genetically transform target microorganisms, and to transform them in a targeted manner. Its metabolic system changes the distribution of metabolic flow, constructs new ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/67C12N15/77C12N1/21C12P13/04C12R1/15
CPCC12N15/67C12N15/77C12N2800/60C12P13/04
Inventor 刘为佳于一航段艳婷何志云孙悦詹依袁莉莉张晓娟张晓梅徐国强史劲松许正宏
Owner JIANGNAN UNIV