Regulatory protein AraR mutant synthesized by fungus alpha-L-arabinofuranosidase and application thereof
A technology of furanosidase and regulatory protein, applied in the field of mutants of fungal α-L-arabinofuranosidase synthesis regulatory protein AraR, and mutants of arabinofuranosidase synthesis regulatory protein, which can solve the problem of low yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1 Amplification of the gene encoding the Penicillium oxalicum α-L-arabinofuranosidase regulatory protein AraR mutant
[0036] Strain: Penicillium oxalicum wild strain 114-2, which was deposited in China General Microorganism Culture Collection Management Center on September 28, 2011, with the preservation number CGMCC 5302. The GenBank accession number of the genome sequence is AGIH00000000.1. This strain has been disclosed in the patent "An extracellular aldonolactonase PoALAC and its application" (patent number: ZL 2016 1 1056999.7) previously applied by the applicant.
[0037] The amino acid sequence of AraR in Penicillium oxalicum is shown in SEQ ID NO.1. Using the genomic DNA of Penicillium oxalicum 114-2 as a template, the front-end coding sequence of araR was amplified using primers araR-CDS-UF and araR-CDS-UR, and araR was amplified using primers araR-CDS-DF and araR-CDS-DR The back-end coding sequence and terminator sequence, and introduce the nucleic...
Embodiment 2A
[0048] Example 2 AraR Mutant AraR A731V Construction of encoding gene expression cassettes
[0049] In order to express AraR and its mutant AraR A731V , using primers gpdA-F and gpdA-R to amplify the gpdA gene promoter of Aspergillus nidulans, and using primers hph-F and hph-R to amplify the hygromycin B phosphotransferase gene hph expression cassette. The PCR procedure for fragment amplification is the same as in Example 1.
[0050] The primer sequences used in the above amplification process are:
[0051] gpdA-F:GTAAGGATTTCGGCACGG
[0052] gpdA-R: GGTGATGTCTGCTCAAGCGG
[0053] hph-F:CGACGTTAACTGATATTGAA
[0054] hph-R:CAACCCAGGGCTGGTGACGG
[0055] Using the overlap extension PCR method, the amplified fragment was fused according to the order of gpdA gene promoter, araR mutant coding region and terminator, and hph expression cassette to obtain AraR A871V Encoding gene expression cassette. The PCR procedure for fragment fusion is the same as in Example 1. The obtain...
Embodiment 3
[0056] Example 3 AraR Mutant AraR A731V Expression in Penicillium oxalicum
[0057] Strain: Penicillium oxalicum CX C , which was constructed by the applicant from the Penicillium oxalicum 114-2 strain described in Example 1, and the specific construction method is reported in the literature (Biotechnology Journal 2017, 12(11): 1700119).
[0058] Obtain AraR mutant AraR in embodiment 2 A731V Encoding gene expression cassette transferred into CX by protoplast transformation method C Bacterial strains, the reagent formula used is:
[0059] Protoplast transformation buffer:
[0060] Transformation solution S1 (100ml): 21.86g sorbitol, 1.36g KH 2 PO 4 , pH 5.6.
[0061] Transformation solution S2 (100ml): 18.22g sorbitol, 0.74g CaCl 2 , 0.12g Tris, adjusted to pH 7.5 with HCl.
[0062] Transformation solution T1 (100ml): 25g PEG 6000, 0.74g CaCl 2 , 0.12g Tris, adjusted to pH 7.5 with HCl.
[0063] The above transformation buffers need to be sterilized for later use.
...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com