Method for establishing tomato nuclear male sterile line with green stem marker

A male sterile line, tomato technology, applied in the field of creation of tomato nuclear male sterile line, can solve the problems of low breeding efficiency and low seed purity of tomato nuclear male sterile line

Inactive Publication Date: 2019-05-10
NORTHWEST A & F UNIV
View PDF3 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In view of this, the embodiment of the present invention provides a method for creating a tomato genic male sterile line with a green stem marker, the main purpose of which is to solve the problems of low breeding efficiency and low seed purity of the tomato genic male sterile line

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for establishing tomato nuclear male sterile line with green stem marker
  • Method for establishing tomato nuclear male sterile line with green stem marker
  • Method for establishing tomato nuclear male sterile line with green stem marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1 (SlMs10 35 , SlF3H and SlDFR target selection and construction of CRISPR / Cas9 gene editing vector)

[0036] 1. SlMs10 35 and SlF3H target selection

[0037] SlMs10 35 The gene numbers of the SlF3H gene in the tomato database are Solyc02g079810 and Solyc02g083860, both of which are located at the same end of the second chromosome of tomato. Using the online software CRISPR-PLANT (http: / / www.genome.arizona.edu / crispr / CRISPRsearch.html ) to design a target on each gene to construct a gene editing vector, the selected target sequence is as follows, and the underlined is the PAM region (prespacer sequence adjacent motif).

[0038] SlMs10 35 The target of the gene is located in the second exon region, and the target sequence is: TGACGCCATCACCTACATTA GGG (sequence 5);

[0039] The target of the SlF3H gene is located in the second exon region, and the target sequence is: GAGCTAGAGACTATTCTAGA TGG (sequence 6);

[0040] 2. Construction of recombinant vector...

Embodiment 2

[0045] Embodiment 2 (transformation tomato)

[0046] The recombinant plasmid pKSE401-SlMs10 constructed in Example 1 35 +SlF3H was respectively introduced into tomato material 5N21 using Agrobacterium; the aseptic cotyledon of 5N21 was used as the transformation recipient, and Agrobacterium containing the recombinant plasmid was used to mediated transformation, and the complete regenerated plant was obtained through tissue culture after transformation;

[0047] Since the plants cannot produce anthocyanins after the SlF3H gene loses its function, the stems or young parts of the plants will not appear purple, so the plants with SlF3H gene editing can be selected;

[0048] Extract the genomic DNA of the plants selected above, and use specific primers to amplify the DNA containing SlMs10 35 and the gene sequence of the SIF3H target site; the amplified PCR product was TA-cloned to the T vector pEASY-T1 (Beijing Quanshijin Biotechnology Co., Ltd., CT101-01), and 5 single clones wer...

Embodiment 3

[0055] Embodiment 3 (slms10 35 Phenotype identification of slf3h-Cas9 plants)

[0056] slms10 obtained in Example 2 35 The slf3h-Cas9 plants were planted together with the wild-type 5N21 in the greenhouse, and the color of the stem, the shape of the flower and the development of pollen were observed; Figure 4 Planted seedlings are shown, wild-type 5N21 stems appear purple, while slms10 35 slf3h plant stems appear green; as Figure 5 As shown, when the plant grows to the second panicle of flowers, take the flowers that are fully open on the day of the plant for observation, and it can be seen that slms10 35 The flowers of the slf3h plant were smaller than the wild-type 5N21, and the stigma of the double mutant was obviously exposed due to the shortening of the stamens; the pollen was stained by Alexander's stain, and the pollen dyed red could be observed in the wild-type 5N21, while the slms10 35 Dyed pollen could not be observed in slf3h plants.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for establishing a tomato nuclear male sterile line with a green stem marker, which comprises the following steps: simultaneously editing a fertility gene SlMs1035 ina receptor tomato genome and a linked marker gene SlF3H thereof by using a CRISPR / Cas9 system so as to cause the two genes to lose functions, and the tomato material obtained with the SlMs1035 and theSlF3H simultaneously losing function through ridding the transgene structure by carrying out selfing or hybridization is the tomato nuclear male sterile line with the green stem mark; wherein the marker gene SlF3H is an anthocyanin synthesis gene. As the stem of the sterile plants is green at the seedling stage, the sterile plants can be selected before the plants blossom. The method for establishing tomato nuclear male sterile line with the green stem marker adopts a molecular design breeding method to obtain a tomato nuclear male sterile line with a non-transgenic seedling stage marker character, and can be applied to transforming a tomato hybrid female parent into a nuclear sterile line with a green stem marker for tomato seed production through hybrid.

Description

technical field [0001] The invention relates to the technical field of molecular breeding, in particular to a method for establishing a tomato nuclear male sterile line with a green stem marker. Background technique [0002] Tomato (Lycopersiconesculentum Mill.) is a self-pollinated crop with obvious heterosis. The seeds of the first generation of hybrids have high uniformity and strong stress resistance. Using the male sterile parent as the female parent for hybrid seed production can save labor. Male process, reduce costs, improve seed purity. However, the production of first-generation tomato hybrid seeds in my country still adopts artificial castration and pollination, which requires a lot of manpower and material resources, low seed production efficiency, high cost, and seed purity cannot be guaranteed. [0003] In order to obtain tomato male sterility suitable for production, over the past decades, a large number of breeders have found more than 60 mutation materials ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/82C12N9/22A01H5/00A01H6/82
Inventor王晓峰刘建伟汪淑芬罗伯特
OwnerNORTHWEST A & F UNIV