A new mysterious strain of Ganoderma lucidum and its artificial cultivation method and application
A cultivation method, Ganoderma lucidum technology, which is applied in the field of rare medicinal fungus new strains and their artificial cultivation, can solve the problems of not being applied, and achieve the effect of good domestication conversion rate and obvious effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Ganoderma enigmaticum
[0059] In April 2016, Wang Lusheng collected a specimen of Ganoderma lucidum in Rudewa Ward, Kilosa District, Morogoro Region near the capital of Tanzania (coordinates: 6°37'28" south latitude, 37°9'1" east longitude), such as figure 1 shown. The PDA pure culture was obtained by the tissue isolation method by the researchers of the Edible Fungus Research and Development Center of the Guangdong Institute of Microbiology. The mycelium was collected by liquid culture, dried at low temperature (40°C), ground with liquid nitrogen, and the Ezup column fungal genome was used. DNA extraction kit for DNA genome extraction, and the obtained DNA solution is refrigerated at -20°C for later use. The ITS-PCR experiment of the material was carried out by the universal primers ITS1 / ITS4 (ITS1: TCCGTAGGTGAACCTGCGG, ITS4: TCCTCCGCTTATTGATATGC, synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.) of the fungal ribosomal intergenic region, and the amplificati...
Embodiment 2
[0070] 1. Culture medium (by weight percentage):
[0071] 1. Tissue isolation medium (comprehensive PDA):
[0072] Potato 20%, glucose 2%, agar 2%, potassium dihydrogen phosphate 0.3%, magnesium sulfate 0.15%, a trace amount of vitamin B1, and the rest are water.
[0073] 2. Mother seed medium (Red Bengal medium):
[0074] Peptone 0.5%, glucose 1%, potassium dihydrogen phosphate 0.1%, magnesium sulfate (MgSO 4 ·7H 2 O) 0.05%, agar 2%, 1 / 3000 red Bengal solution 10%, chloramphenicol 0.01%, and the rest is water.
[0075] 3. Production of parent seed medium (enriched with comprehensive PDA):
[0076] Potato 20%, glucose 2%, peptone 1%, agar 2%, potassium dihydrogen phosphate 0.3%, magnesium sulfate 0.15%, a trace amount of vitamin B1, and the rest is water.
[0077] 4. Production of seed culture medium:
[0078] 98-99% sorghum, 1-2% calcium carbonate.
[0079] 5. Cultivation materials:
[0080] 38% Cottonseed Hulls, 50% Wood Chips, 10% Bran, 2% CaCO 3 , the moisture of ...
Embodiment 3
[0100] The Ganoderma lucidum crude polysaccharide and Ganoderma lucidum triterpenes were detected on the fruiting bodies of the mysterious Ganoderma lucidum new strain CCTCC NO:M 2019093 cultivated in Example 2. The total triterpenes were determined by the oleanolic acid method, and the ganoderma A was determined by the high performance liquid method.
[0101] 1. Detection of Ganoderma lucidum polysaccharide
[0102] The extraction of crude polysaccharide was carried out according to the NY / T1676-2008 method for the determination of crude polysaccharide content in edible fungi. Methods as below:
[0103] 1. Preparation of glucose standard curve
[0104] Accurately weigh 50 mg of standard glucose with dry constant weight at 105 °C, put it in a 500 ml volumetric flask, add distilled water to dissolve and dilute to the mark. Pipette 0.00ml, 0.20ml, 0.40ml, 0.60ml, 0.80ml, 1.00ml of glucose standard solution, and place them in colorimetric tubes with stoppers. Add distilled wat...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


