Unlock instant, AI-driven research and patent intelligence for your innovation.

A new mysterious strain of Ganoderma lucidum and its artificial cultivation method and application

A cultivation method, Ganoderma lucidum technology, which is applied in the field of rare medicinal fungus new strains and their artificial cultivation, can solve the problems of not being applied, and achieve the effect of good domestication conversion rate and obvious effect

Active Publication Date: 2022-05-27
GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Modern pharmacological and clinical research results also show that Ganoderma lucidum contains active ingredients that inhibit tumors and regulate immunity, but it has not been practically applied in this regard

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A new mysterious strain of Ganoderma lucidum and its artificial cultivation method and application
  • A new mysterious strain of Ganoderma lucidum and its artificial cultivation method and application
  • A new mysterious strain of Ganoderma lucidum and its artificial cultivation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Ganoderma enigmaticum

[0059] In April 2016, Wang Lusheng collected a specimen of Ganoderma lucidum in Rudewa Ward, Kilosa District, Morogoro Region near the capital of Tanzania (coordinates: 6°37'28" south latitude, 37°9'1" east longitude), such as figure 1 shown. The PDA pure culture was obtained by the tissue isolation method by the researchers of the Edible Fungus Research and Development Center of the Guangdong Institute of Microbiology. The mycelium was collected by liquid culture, dried at low temperature (40°C), ground with liquid nitrogen, and the Ezup column fungal genome was used. DNA extraction kit for DNA genome extraction, and the obtained DNA solution is refrigerated at -20°C for later use. The ITS-PCR experiment of the material was carried out by the universal primers ITS1 / ITS4 (ITS1: TCCGTAGGTGAACCTGCGG, ITS4: TCCTCCGCTTATTGATATGC, synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.) of the fungal ribosomal intergenic region, and the amplificati...

Embodiment 2

[0070] 1. Culture medium (by weight percentage):

[0071] 1. Tissue isolation medium (comprehensive PDA):

[0072] Potato 20%, glucose 2%, agar 2%, potassium dihydrogen phosphate 0.3%, magnesium sulfate 0.15%, a trace amount of vitamin B1, and the rest are water.

[0073] 2. Mother seed medium (Red Bengal medium):

[0074] Peptone 0.5%, glucose 1%, potassium dihydrogen phosphate 0.1%, magnesium sulfate (MgSO 4 ·7H 2 O) 0.05%, agar 2%, 1 / 3000 red Bengal solution 10%, chloramphenicol 0.01%, and the rest is water.

[0075] 3. Production of parent seed medium (enriched with comprehensive PDA):

[0076] Potato 20%, glucose 2%, peptone 1%, agar 2%, potassium dihydrogen phosphate 0.3%, magnesium sulfate 0.15%, a trace amount of vitamin B1, and the rest is water.

[0077] 4. Production of seed culture medium:

[0078] 98-99% sorghum, 1-2% calcium carbonate.

[0079] 5. Cultivation materials:

[0080] 38% Cottonseed Hulls, 50% Wood Chips, 10% Bran, 2% CaCO 3 , the moisture of ...

Embodiment 3

[0100] The Ganoderma lucidum crude polysaccharide and Ganoderma lucidum triterpenes were detected on the fruiting bodies of the mysterious Ganoderma lucidum new strain CCTCC NO:M 2019093 cultivated in Example 2. The total triterpenes were determined by the oleanolic acid method, and the ganoderma A was determined by the high performance liquid method.

[0101] 1. Detection of Ganoderma lucidum polysaccharide

[0102] The extraction of crude polysaccharide was carried out according to the NY / T1676-2008 method for the determination of crude polysaccharide content in edible fungi. Methods as below:

[0103] 1. Preparation of glucose standard curve

[0104] Accurately weigh 50 mg of standard glucose with dry constant weight at 105 °C, put it in a 500 ml volumetric flask, add distilled water to dissolve and dilute to the mark. Pipette 0.00ml, 0.20ml, 0.40ml, 0.60ml, 0.80ml, 1.00ml of glucose standard solution, and place them in colorimetric tubes with stoppers. Add distilled wat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to a new rare medicinal fungus strain and its artificial cultivation method and application, in particular to a mysterious ganoderma new strain and its artificial cultivation method and application. The new strain of mysterious ganoderma of the present invention is collected from Tanzania, identified as a new strain of mysterious ganoderma, named as mysterious ganoderma (Ganoderma enigmaticum) HMGIM‑I160004, and the preservation number is CCTCC NO: M 2019093. In summary, the present invention provides a new mysterious strain of Ganoderma lucidum and its artificial cultivation method. The domestication conversion rate is good, the average mushroom bag yield is 60.88 grams, the head tide biotransformation rate is 18% and above, and the cultivation process is resistant to High temperature, and its effect of inhibiting tumors in vitro is obvious, so it has development prospects.

Description

technical field [0001] The invention relates to a new strain of rare medicinal fungi and an artificial cultivation method and application thereof, in particular to a new strain of mysterious Ganoderma lucidum and an artificial cultivation method and application thereof. Background technique [0002] At present, the industry of edible and medicinal fungi is developing rapidly. According to the statistics of China Edible Fungi Association, the output of edible and medicinal fungi in my country reached 37.12 million tons in 2017, an increase of 3.21% over 2016, and the output value was 272.192 billion yuan. my country accounted for 75% of the world's total. % and more than 20 million employees. The edible fungus industry ranks fifth in the planting industry after grain, vegetables, fruit and oil, surpassing tea and sericulture. [0003] Today, with the booming development of the edible and medicinal mushroom industry, more and more rare edible and medicinal mushroom species hav...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/14A01G18/00C12R1/645
CPCC12N1/14A01G18/00C12R2001/645C12N1/145
Inventor 胡惠萍吴清平刘远超谢意珍莫伟鹏卓丽君张智
Owner GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY