Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for preparing protease 3 recombinant protein

A recombinant protein and protease technology, applied in the field of preparing protease 3 recombinant protein, can solve the problems of difficult separation and purification of natural protein, inconsistent between batches, low product purity, etc. Effect

Inactive Publication Date: 2019-08-02
JIANGSU UNIV
View PDF19 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Human natural protein (such as neutrophil source) is the best PR3 clinically used for in vitro diagnosis of autoimmune system-related diseases, but the separation and purification of natural protein is difficult, the yield is low, and the purity of the purified product is low, and a certain amount of Miscellaneous proteins; the sources of products are different, inconsistent between batches, and the cost is high, which seriously restricts the development of in vitro diagnostic technology for autoimmune system-related diseases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing protease 3 recombinant protein
  • Method for preparing protease 3 recombinant protein
  • Method for preparing protease 3 recombinant protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: Construction of recombinant donor vector pFastBac1-Mel-PR3-His containing insect secretion signal peptide Mel

[0040] PCR amplification primers were designed using the cDNA of human PR3 (GenBankNo: X55668.1) as a template, and Xho I and Kpn I restriction sites were introduced at the N-terminal and C-terminal of the human PR3 gene sequence, so as to ligate the fragments Into the plasmid vector after double enzyme digestion; its C-terminus introduces 6 bases encoding histidine to facilitate the purification of expressed protein: the primers are as follows:

[0041] Forward primer-1 (SEQ ID NO.1): AGGAGACTCGAGATCGTGGGCGGGCACGAGGCG; Reverse primer-1 (SEQ ID NO.2): TACGGTACCCTAGTGATGGTGATGGTGATGACGGCGCAGCGTGGAACG.

[0042] Using the above primers, the first round of PCR amplification reaction was carried out using the cDNA of human PR3 as a template. The reaction system and conditions are shown in Table 1:

[0043] Table 1. PCR amplification reaction system and ...

Embodiment 2

[0051] Example 2: Preparation of recombinant Bombyx mori baculovirus rBm-pFastBac1-Mel-PR3-His

[0052] The recombinant donor vector pFastBac1-Mel-PR3-His constructed in Example 1 containing the insect secretion signal peptide Mel was transfected into Escherichia coli BmDH10Bac, the Tn7 transposable element contained in the vector pFastBac1-Mel-PR3-His and the silkworm BmNPV rod The recombined shuttle vector was identified after the transposition of Bacmid, a virus shuttle vector, was screened by blue and white. Randomly select 2 Bacmid DNA recombinant shuttle vectors of white spot, and use non-recombinant Bacmid DNA of blue spot as a control, apply specific universal pUC / M13 forward primer (SEQ ID NO.5): 5'-CCCAGTCACGACGTTGTAAAACG-3' and reverse Primer (SEQ ID NO.6): 5'-AGCGGATAACAATTTCACACAGG-3', used for PCR reaction verification of recombinant shuttle vector Bacmid DNA.

[0053] Figure 5 It is the result of PCR amplification of recombinant and non-recombinant shuttle ve...

Embodiment 3

[0055] Example 3: Expression of recombinant Bombyx mori baculovirus rBm-pFastBac1-Mel-PR3-His in fifth instar silkworm

[0056] The recombinant Bombyx mori baculovirus rBm-pFastBac1-Mel-PR3-His prepared in Example 2 was inoculated into silkworms on the second day after transfection to the fifth instar, and each silkworm was subcutaneously injected with 5 µL of recombinant Bombyx mori baculovirus rBm-pFastBac1 -Mel-PR3-His, that is: each silkworm was inoculated with 1.0×10 5PFU virus. After virus inoculation, silkworm hemolymph was collected every 24 hours. At the same time, non-virus-inoculated silkworms were used as a negative control group to collect hemolymph together with virus-inoculated silkworms. Human PR3 protein ELISA detection kit was used to collect 5 samples at different times. The mixed hemolymph of the head silkworm was used as a sample, and the ELISA activity of the human PR3 protein contained in the hemolymph and the human PR3 antibody coated on the microwell ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical fields of gene engineering and biology, in particular to a method for preparing protease 3 recombinant protein. The method for preparing the protease 3 recombinant protein comprises the steps of using fifth-instar-stage silkworm larvae as a bioreactor, and through a silkworm-baculovirus expression system, the recombinant human PR3 with immunocompetence is prepared on a large scale at low cost efficiently. Through the method, the fifth-instar silkworms are infected by recombinant baculovirus, after infection, PR3 fusion protein is expressed in the silkworms, and is released to hemolymph, after separation and purification are conducted, each silkworm can prepare about 2 micrograms of the targeted protease 3, the silkworms have very large expression quantity, the production cost is effectively reduced, and large-scale industrial production is facilitated, so that the silkworms have excellent economic benefits.

Description

technical field [0001] The invention relates to the fields of genetic engineering and biotechnology, in particular to a method for preparing protease 3 recombinant protein. Background technique [0002] Protease 3 (Proteinase 3, PR3) is a serine protease in neutrophil cytoplasmic azurophilic granules, a glycoprotein with a molecular weight of about 29KDa. It is the main target antigen of anti-neutrophil and monocyte cytoplasmic antibodies (Anti-Neutrophil Cytoplasmic Antibodies, ANCA), accounting for about 80% - 90%. With ANCA, the two fluorescence modes of indirect immunofluorescence (cytoplasmic cANCA and perinuclear pANCA) have become an established tool for the diagnosis of diseases such as autoimmune systemic vasculitis and inflammatory diseases. For example, since cANCA mainly recognizes PR3, the specificity of diagnosis of Wegener's granulomatosis (WG) by PR3-cANCA is greater than 95%, and it is also commonly used in the detection of various other primary vasculitis....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/64C12N15/57C12N15/866C12N15/65
CPCC12N9/64C12N15/86C12N15/65C12N2710/14043
Inventor 刘晓勇张倩扬玉龙张茜孙祥明陈慧卿陈克平麦维军吕鹏周亚竟
Owner JIANGSU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com