Trypsin precursor gene and its encoded protein, interfering RNA and application thereof
A technology of trypsin and gene encoding, which is applied in the trypsin precursor gene and its encoded protein, interfering RNA and application fields. The effect of longevity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Cloning and functional analysis of the trypsin precursor gene of Lygus melanogaster
[0031] RNA extraction by TRIzol method
[0032] 1) Tissue lysis: take 30mg of Lygus melanogaster sample and put it in a 1.5ml enzyme-free tube, pre-cool it with liquid nitrogen, grind the female with a grinding rod until it is ground into powder, add 1000μl RNAisoplus lysate to the tube, and let it stand at room temperature 5min.
[0033] 2) Centrifuge at 12000×g for 5 minutes at 4°C.
[0034] 3) Transfer the supernatant to a new 1.5 ml RNA enzyme-free tube, and add 200 μl of chloroform. Shake vigorously to mix.
[0035] 4) Stand at room temperature for 5 minutes.
[0036] 5) Centrifuge at 12000×g for 15 minutes at 4°C.
[0037] 6) Transfer the supernatant to a new 1.5ml RNA enzyme-free tube, and add an equal volume of isopropanol to the supernatant. Mix by inverting.
[0038] 7) Stand at room temperature for 10 minutes.
[0039] 8) Centrifuge at 12000×g for 10 minutes at 4°C.
...
Embodiment 2
[0061] synthetic dsRNA
[0062] 1. Preparation of dsRNA template
[0063] According to the trypsin precursor gene sequence obtained in Example 1, the dsRNA region was predicted by siDirect version 2.0 (http: / / sidirect2.rnai.jp / ), and the online software (http: / / primer3.ut.ee / ) was used Design specific amplification primers (5'-end plus T7 promoter sequence: gcgtaatacgactcactatagg (SEQ ID NO: 14)), for the amplification of the dsRNA fragment of trypsin precursor gene, the specific primers designed are as follows:
[0064] Upstream primer sequence dsTryP-F: gcgtaatacgactcactatagg gcagacccgacaacaacgaag (SEQ ID NO: 4),
[0065] Downstream primer sequence dsTryP-R: gcgtaatacgactcactatagg ccagaatctccttggcaagc (SEQ ID NO: 5).
[0066] Using the cDNA of Lygus melanogaster as a template, PCR amplification was carried out using the above primers dsTryP-F and dsTryP-F, and the PCR reaction system was prepared according to the instruction manual of Ex Taq enzyme from Japan Takara Co...
Embodiment 3
[0100] The gene silencing efficiency and its effect on the number and fecundity of eggs in female ovaries after injection of trypsin precursor gene dsRNA
[0101] Using the double-stranded dsRNA of the green fluorescent protein gene (GFP) as a control, the dsRNA of the trypsin precursor gene was injected into the newly eclovened females from the outermost side of the hind thorax and abdominal intersegmental membrane of Lygus chinensis by microinjection. 1.0μg / piece.
[0102] The sequence of the double-stranded dsRNA of green fluorescent protein (GFP) is shown in SEQ ID NO: 11: tggtcccaattctcg tggaac tggatggcgatgtgaatgggcacaaattttctgtcagcggagagggtga aggtgatgccacatacggaaagctcaccctgaaattcatctgcaccactggaaagctccctgtgccatgg ccaacactggtcactaccttcacctatggcgtgcagtgcttttccagatacccagaccatatgaagcagca tgactttttcaagagcgccatgcccgagggctatgtgcaggagagaaccatctttttcaaagatgacggg aactacaagacccgcgctgaagtcaagttcgaaggtgacaccctggtgaatagaatcgagctgaaggg cattgactttaaggaggatggaaacattctcggccacaagctggaata...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Molecular mass | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 



