Trypsin precursor gene and its encoded protein, interfering RNA and application thereof

A technology of trypsin and gene encoding, which is applied in the trypsin precursor gene and its encoded protein, interfering RNA and application fields. The effect of longevity

Inactive Publication Date: 2019-09-03
HUAZHONG AGRI UNIV
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the research on trypsin precursor in insects is mainly the study of its activation product tryps...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Trypsin precursor gene and its encoded protein, interfering RNA and application thereof
  • Trypsin precursor gene and its encoded protein, interfering RNA and application thereof
  • Trypsin precursor gene and its encoded protein, interfering RNA and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Cloning and functional analysis of the trypsin precursor gene of Lygus melanogaster

[0031] RNA extraction by TRIzol method

[0032] 1) Tissue lysis: take 30mg of Lygus melanogaster sample and put it in a 1.5ml enzyme-free tube, pre-cool it with liquid nitrogen, grind the female with a grinding rod until it is ground into powder, add 1000μl RNAisoplus lysate to the tube, and let it stand at room temperature 5min.

[0033] 2) Centrifuge at 12000×g for 5 minutes at 4°C.

[0034] 3) Transfer the supernatant to a new 1.5 ml RNA enzyme-free tube, and add 200 μl of chloroform. Shake vigorously to mix.

[0035] 4) Stand at room temperature for 5 minutes.

[0036] 5) Centrifuge at 12000×g for 15 minutes at 4°C.

[0037] 6) Transfer the supernatant to a new 1.5ml RNA enzyme-free tube, and add an equal volume of isopropanol to the supernatant. Mix by inverting.

[0038] 7) Stand at room temperature for 10 minutes.

[0039] 8) Centrifuge at 12000×g for 10 minutes at 4°C.

...

Embodiment 2

[0061] synthetic dsRNA

[0062] 1. Preparation of dsRNA template

[0063] According to the trypsin precursor gene sequence obtained in Example 1, the dsRNA region was predicted by siDirect version 2.0 (http: / / sidirect2.rnai.jp / ), and the online software (http: / / primer3.ut.ee / ) was used Design specific amplification primers (5'-end plus T7 promoter sequence: gcgtaatacgactcactatagg (SEQ ID NO: 14)), for the amplification of the dsRNA fragment of trypsin precursor gene, the specific primers designed are as follows:

[0064] Upstream primer sequence dsTryP-F: gcgtaatacgactcactatagg gcagacccgacaacaacgaag (SEQ ID NO: 4),

[0065] Downstream primer sequence dsTryP-R: gcgtaatacgactcactatagg ccagaatctccttggcaagc (SEQ ID NO: 5).

[0066] Using the cDNA of Lygus melanogaster as a template, PCR amplification was carried out using the above primers dsTryP-F and dsTryP-F, and the PCR reaction system was prepared according to the instruction manual of Ex Taq enzyme from Japan Takara Co...

Embodiment 3

[0100] The gene silencing efficiency and its effect on the number and fecundity of eggs in female ovaries after injection of trypsin precursor gene dsRNA

[0101] Using the double-stranded dsRNA of the green fluorescent protein gene (GFP) as a control, the dsRNA of the trypsin precursor gene was injected into the newly eclovened females from the outermost side of the hind thorax and abdominal intersegmental membrane of Lygus chinensis by microinjection. 1.0μg / piece.

[0102] The sequence of the double-stranded dsRNA of green fluorescent protein (GFP) is shown in SEQ ID NO: 11: tggtcccaattctcg tggaac tggatggcgatgtgaatgggcacaaattttctgtcagcggagagggtga aggtgatgccacatacggaaagctcaccctgaaattcatctgcaccactggaaagctccctgtgccatgg ccaacactggtcactaccttcacctatggcgtgcagtgcttttccagatacccagaccatatgaagcagca tgactttttcaagagcgccatgcccgagggctatgtgcaggagagaaccatctttttcaaagatgacggg aactacaagacccgcgctgaagtcaagttcgaaggtgacaccctggtgaatagaatcgagctgaaggg cattgactttaaggaggatggaaacattctcggccacaagctggaata...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Molecular massaaaaaaaaaa
Login to view more

Abstract

The invention provides a trypsin precursor gene and its encoded protein, interfering RNA and an application thereof, which belong to the technical field of insect gene engineering. A cDNA sequence ofthe trypsin precursor gene is shown as SEQ ID NO: 1; an amino acid sequence of the protein is shown as SEQ ID NO: 2; a nucleotide sequence of the interfering RNA is shown as SEQ ID NO: 3; the expression level of the trypsin precursor gene in adelphocoris suturalis in Miridae is reduced, the quantity of eggs in the adelphocoris suturalis ovary and the final production of eggs can be significantly reduced, and the life span of female adults can be shortened. The application provided by the invention can eventually lead to the decline of the population development, provides a new idea for controlling the development of the adelphocoris suturalis population, and also provides a theoretical basis for the realization of adelphocoris suturalis and other hemipteran insects in green control.

Description

technical field [0001] The invention belongs to the technical field of insect genetic engineering, and in particular relates to a trypsin precursor gene and its encoded protein, interference RNA and application. Background technique [0002] Adelphocoris suturalis belongs to Hemiptera Miridae. It is distributed in North Korea, Japan, eastern and coastal areas of Siberia, and the Caucasus. It is mainly concentrated in the Yangtze River Basin and Yellow River Basin in China (Jiang Yuying et al., Regional monitoring and management of Lygus bugs. 2015, Beijing: Beijing China Agricultural Press). Since the planting of Bt cotton in 1997, Lygus chinensis has changed from a minor pest to a major pest, and Lygus medusa is one of the main pests in cotton planting areas in the Yangtze River Basin of my country (Lu Yanhui et al., Research progress on comprehensive management of Lygus cotton. Plant Protection, 2007.06,10-15; Wu K, Lu YH, Feng HQ, Jiang YY, Zhao JZ, 2008.Suppression of Co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/57C12N9/64C12N15/113C12N15/11A01H5/00A01N57/16A01P7/04
CPCA01N57/16C12N9/6408C12N15/113C12N15/8286C12N2310/14C12Y304/21004
Inventor 陈利珍朱邦勤朱俊宇彭捷任俊薛汇
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap