Unlock instant, AI-driven research and patent intelligence for your innovation.

Preparation method of universal short tandem repeat (STR) allele ladder

A technology of short tandem repeats and alleles, applied in the field of allelic ladder preparation, can solve the problems of large workload and cost, high cost of whole gene synthesis, deviation of allele yield, etc., and achieves saving cycle and cost, saving Workload and production cost, the effect of saving labor cost and time cost

Active Publication Date: 2019-09-13
上海晶准生物医药有限公司
View PDF8 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0018] (3) Although the method of gene cloning is a solution to the need to continuously collect different DNA samples, for a typing kit containing 20 different STR loci, it is often necessary to complete hundreds of alleles Gene cloning requires huge workload and cost
However, the problem with this solution is that first, the cost of whole gene synthesis is high, and second, the technical difficulty for whole gene synthesis of repeat structure is high, especially for STR genes with long repeat domains, such as FGA
[0020] (5) Even after the cloning of all alleles is obtained by gene cloning or whole gene synthesis, a more complicated process is how to mix hundreds of alleles equally
When carrying out plasmid mixing, the slight difference of different allelic plasmid templates also can lead to the significant deviation of each allelic yield in the PCR product obtained after PCR amplification (as seen in the accompanying drawing of CN105886497A)
[0021] (6) However, if a single allele clone is used for saturated PCR amplification, the PCR products of different alleles are purified, quantified and remixed, although the significant deviation of the content of different allele fragments in the allele ladder can be reduced, but due to this The workload in the process is huge, and the impact of this mixing process on the production environment (mainly the possibility of contamination of PCR products) is also a problem that cannot be ignored for a long time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of universal short tandem repeat (STR) allele ladder
  • Preparation method of universal short tandem repeat (STR) allele ladder
  • Preparation method of universal short tandem repeat (STR) allele ladder

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0070] The invention relates to a method for preparing a general short tandem repeat allelic ladder, which comprises the following steps: (1) designing and synthesizing primers and plasmids according to the STR locus; (2) using primers and using the plasmid as an amplification template , carry out PCR amplification reaction; (3) purify PCR amplification product, obtain STR allele ladder after appropriate dilution; Wherein, following structural formula is the general formula of the artificially synthesized plasmid of preparation STR locus allele ladder that the present invention proposes Structural formula:

[0071]

Embodiment 1

[0074] In this embodiment, D13S317 is taken as an example to prepare the STR locus allele ladder.

[0075] (1) Design of D13S317 locus allele ladder plasmid

[0076] In The Genome Browser database (http: / / genome.ucsc.edu / , the human genome reference sequence version is selected as Hg19), the 1000bp reference sequence of the D13S317 locus centered on the core repeat sequence is obtained as follows, and the core repeat sequence is Shaded display.

[0077] >D13S317_Hg19

[0078]

[0079] The underlined upstream of the core repeat sequence is the sequence of the forward primer F, and the downstream is the reverse complementary sequence Rc of the reverse primer R.

[0080] The forward primer F and reverse primer R for PCR amplification of the D13S317 locus were designed based on the reference sequence, wherein the sequences of the forward amplification primer f and the reverse amplification primer r are respectively:

[0081] F = ATTACAGAAGTCTGGGATGTGGAGGA (SEQ ID No. 1)

[...

Embodiment 2

[0110] This example is the verification of the validity of the allelic ladder at the D13S317 locus prepared in Example 1.

[0111] Randomly select 5 cases of human genomic DNA samples with a concentration of 3ng / μL, and use the following PCR reaction system to amplify (Table 3):

[0112] Table 3 - Sample D13S317 locus PCR amplification system

[0113] Reactive components Volume (μL) PCR buffer (10x) 2.0 TaqDNA polymerase (5U / μL) 0.5 Forward primer F(5M) 1.0 Reverse primer R(5M) 1.0 Human Genomic DNA (3ng / μL) 1.0 wxya 2 o

14.5 total reaction system 20.0

[0114] Amplification was performed using the following thermal cycling conditions (Table 4):

[0115] Table 4 - Sample D13S317 locus PCR thermocycling conditions

[0116]

[0117] The effectiveness of the prepared D13S317 locus allele ladder was verified by capillary electrophoresis.

[0118] The LIZ500 internal standard and Hi-Di of AB Company and 3500Dx gene...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a preparation method of a universal short tandem repeat (STR) allele ladder. The preparation method comprises the following steps of (1) designing and synthesizing a primer anda plasmid according to an STR locus; (2) using the primer to perform a PCR amplification reaction by using the plasmid as an amplification formwork; and (3) performing purification on PCR amplification products, and performing appropriate dilution so as to obtain the STR allele ladder. According to the preparation method disclosed by the invention, only one plasmid needs to be synthesized, the PCRreaction needs to be performed only once, and after the PCR products are subjected to purification and dilution, the allele ladder of the corresponding STR locus can be obtained, so that the preparation technological process of the allele ladder of the STR locus is greatly simplified, and labor cost,, time cost and economic cost for preparation are saved.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a method for preparing a general short tandem repeat (STR) allele ladder (Allele Ladder) and a kit thereof. Background technique [0002] A genetic marker called short tandem repeat (STR) exists in human and various genomes. STR is widely used in the research of genetics, forensic science, oncology, etc., especially those STR genetic markers with high polymorphism in the population. Such as Dib C and his colleagues in 1996 (Nature.1996 Mar 14; 380(6570):152-4.PMID:8600387), Broman KW is equal to 1998 (Am J Hum Genet.1998 Sep; 63(3):861- 9.PMID:9718341), Kong A et al. in 2002 (Nat Genet.2002 Jul; 31(3):241-7.PMID:12053178) used 5236, 8325, and 5136 STR genetic markers respectively for high-resolution Genetic mapping of the human genome. In the field of forensic science, STR markers have become standard genetic markers for individual identification and parentage dete...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6806C12Q1/6858
CPCC12Q1/6806C12Q1/6858C12Q2525/151Y02A50/30
Inventor 赵琪金云舟王丽
Owner 上海晶准生物医药有限公司