Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cell line to express anti-newcastle disease virus fusion protein and construction method and application thereof

An anti-Newcastle disease virus, fusion protein technology, applied in immunoglobulins, cells modified by introducing foreign genetic material, applications, etc., can solve the need for many components, complex production process and complex production process required for the assembly of commercial kits and other problems to achieve the effect of reducing inspection costs, reducing inspection efficiency and increasing production costs

Pending Publication Date: 2019-09-20
NORTHWEST A & F UNIV
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

ELISA kits for the detection of chicken-derived NDV antibodies have been widely produced and used clinically. However, in the production process of such kits, either an enzyme-labeled anti-chicken secondary antibody (indirect ELISA) or an anti-NDV nucleocapsid protein is required. Therefore, it has the disadvantages of complex production process, high cost, and many components required for the assembly of commercial kits. For example, the most frequently used ELSA kit for detecting anti-NDV antibodies in chicken serum from IDEXX is currently on the market. , the kit needs to prepare horseradish peroxidase (HRP)-labeled goat anti-chicken secondary antibody. The production procedure is to first isolate and purify chicken IgY, and then immunize it with sheep. After separating goat anti-chicken IgY, the enzyme mark, the generation process is complicated, resulting in high cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cell line to express anti-newcastle disease virus fusion protein and construction method and application thereof
  • Cell line to express anti-newcastle disease virus fusion protein and construction method and application thereof
  • Cell line to express anti-newcastle disease virus fusion protein and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] 1. Construction of cell lines expressing anti-Newcastle disease virus NP protein nanobody-HRP fusion protein

[0053] 1.1 Construction and packaging of recombinant lentiviral vector

[0054] 1.1.1 Synthesis of gene sequence encoding anti-Newcastle disease virus NP protein Nb5-HRP fusion protein

[0055] According to the nucleotide sequence encoding the anti-Newcastle disease virus NP protein nanobody as shown in SEQ ID NO: 1 and the nucleotide sequence of HRP as shown in SEQ ID NO: 2, it was directly synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd., the middle Use a flexible sequence (AGTAGTAGTGGCAGTGGT) for connection, and add a His tag (CATCACCACCATCAC) at the carboxyl end of the fusion gene for easy subsequent detection; at the same time, add EcoR I and BamH I restriction sites at the 5' and 3' ends of the recombinant fusion gene, To facilitate the construction of the recombinant vector, the synthetic gene NDV-Nb5-HRP was connected into the pUC57 vector, and ...

Embodiment 2

[0076] 1. Identification of immune activity of cell line secreting and expressing NDV-Nb5-HRP

[0077] 1.1 Expression and purification of nucleocapsid protein of Newcastle disease virus LaSota strain

[0078] 1) Amplification of NP gene of Newcastle disease virus LaSota strain and construction of recombinant prokaryotic expression vector

[0079]Taking the NDV LaSota strain genome sequence (gene sequence number AF077761) published on GenBank as a reference sequence, it was designed using Primer 5.0 software and synthesized by Xi'an Qingke Bioengineering Co., Ltd., wherein,

[0080] Upstream primer NDV-NP-F: CGCATATGAGCAGCGTGTTCGATGAAT;

[0081] Downstream primer NDV-NP-R: TACTCGAGGTAACCCCAGTCGGTATC.

[0082] Newcastle disease virus LaSota strain vaccine virus liquid (purchased from: attenuated vaccine of Qingdao Yibang NDV, including LaSota vaccine strain) 150μL, use TRIzol method to extract viral RNA, reverse transcription to obtain cDNA, and then use this as a template for...

Embodiment 3

[0099] Anti-NDV Positive Chicken Serum Blocks the Antigen Binding of NDV-Nb5-HRP and NDV-NP Protein

[0100] The prokaryotic expressed NDV-NP protein was coated on the ELISA plate, 100ng / well, incubated overnight at 4°C, 200μL of blocking solution, blocked for 1 hour at 37°C, and serum of different dilutions (1:10, 1:20, 1: 40 and 1:80) into ELISA wells, after incubation at 37°C for 1 hour, add 1:1000 diluted cell culture supernatant (including NDV-Nb5-HRP) to each well, after incubation at 37°C for 1 hour, directly add TMB After 10 minutes of color development, add 3mol H 2 SO 4 Stop color development, ELISA automatic microplate reader OD 45nm reading.

[0101] Figure 8 a and b are the binding levels of NDV-NP-Nb5-HRP and NDV-NP protein in the Newcastle disease virus antibody chicken serum, and the results show that the OD in the positive chicken serum cultured 450nm The value decreased, indicating that the anti-Newcastle disease virus positive chicken serum can well bl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a cell line to express an anti-newcastle disease virus NP protein nanoantibody-HRP fusion protein. The cell line is collected at China Center for Culture Collection Center under C201981. Invention also provides a construction method of the cell line. A lentivirus vector carrying nanoantibody-HRP fusion protein can be transferred successfully into a strain expressing an exogenous gene through the construction method, and the nanoantibody-HRP fusion protein can be expressed stably. The invention also discloses a cell line constructed via the construction method, and application of a fusion protein, expressed by the cell line, in serum detection; the specific application refers to detection of newcastle disease virus in avian serum. Supernate cultured via the cell lien of the invention is suitable for detecting bonding condition of positive avian serum newcastle disease virus antibody and newcastle disease virus NP protein after being diluted according to a titer of 1:1000, thereby judging whether infection of newcastle disease virus occurs; the detection method of the invention is simple and easy to perform, production cost is lowered, and detection efficiency is improved.

Description

technical field [0001] The present invention relates to the field of biotechnology, in particular to a cell line expressing Newcastle disease virus fusion protein and its construction method and application, in particular to a cell line expressing anti-Newcastle disease virus NP protein nanobody-HRP fusion protein and its construction methods and applications. Background technique [0002] Newcastle disease (ND) is an acute, highly contagious infectious disease mainly infecting poultry caused by Newcastle disease virus (NDV). The disease is mainly characterized by digestive tract and respiratory tract lesions, with high morbidity and mortality, which has brought serious harm to the poultry industry. The genome of Newcastle disease virus encodes six structural proteins, namely membrane protein, phosphorylated protein, nucleocapsid protein (NP), hemagglutinin-neuraminidase protein, fusion protein and macromolecular protein (L). NP protein is composed of 489 amino acid residu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/10C12N15/867C07K19/00C12N9/08G01N33/68
CPCC07K16/1027C07K2317/569C07K2319/00C12N9/0065C12N15/86C12N2740/15043C12Y111/01007G01N33/6854
Inventor 赵钦孙亚妮侯高鹏周恩民
Owner NORTHWEST A & F UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com