Cell line to express anti-newcastle disease virus fusion protein and construction method and application thereof
An anti-Newcastle disease virus, fusion protein technology, applied in immunoglobulins, cells modified by introducing foreign genetic material, applications, etc., can solve the need for many components, complex production process and complex production process required for the assembly of commercial kits and other problems to achieve the effect of reducing inspection costs, reducing inspection efficiency and increasing production costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] 1. Construction of cell lines expressing anti-Newcastle disease virus NP protein nanobody-HRP fusion protein
[0053] 1.1 Construction and packaging of recombinant lentiviral vector
[0054] 1.1.1 Synthesis of gene sequence encoding anti-Newcastle disease virus NP protein Nb5-HRP fusion protein
[0055] According to the nucleotide sequence encoding the anti-Newcastle disease virus NP protein nanobody as shown in SEQ ID NO: 1 and the nucleotide sequence of HRP as shown in SEQ ID NO: 2, it was directly synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd., the middle Use a flexible sequence (AGTAGTAGTGGCAGTGGT) for connection, and add a His tag (CATCACCACCATCAC) at the carboxyl end of the fusion gene for easy subsequent detection; at the same time, add EcoR I and BamH I restriction sites at the 5' and 3' ends of the recombinant fusion gene, To facilitate the construction of the recombinant vector, the synthetic gene NDV-Nb5-HRP was connected into the pUC57 vector, and ...
Embodiment 2
[0076] 1. Identification of immune activity of cell line secreting and expressing NDV-Nb5-HRP
[0077] 1.1 Expression and purification of nucleocapsid protein of Newcastle disease virus LaSota strain
[0078] 1) Amplification of NP gene of Newcastle disease virus LaSota strain and construction of recombinant prokaryotic expression vector
[0079]Taking the NDV LaSota strain genome sequence (gene sequence number AF077761) published on GenBank as a reference sequence, it was designed using Primer 5.0 software and synthesized by Xi'an Qingke Bioengineering Co., Ltd., wherein,
[0080] Upstream primer NDV-NP-F: CGCATATGAGCAGCGTGTTCGATGAAT;
[0081] Downstream primer NDV-NP-R: TACTCGAGGTAACCCCAGTCGGTATC.
[0082] Newcastle disease virus LaSota strain vaccine virus liquid (purchased from: attenuated vaccine of Qingdao Yibang NDV, including LaSota vaccine strain) 150μL, use TRIzol method to extract viral RNA, reverse transcription to obtain cDNA, and then use this as a template for...
Embodiment 3
[0099] Anti-NDV Positive Chicken Serum Blocks the Antigen Binding of NDV-Nb5-HRP and NDV-NP Protein
[0100] The prokaryotic expressed NDV-NP protein was coated on the ELISA plate, 100ng / well, incubated overnight at 4°C, 200μL of blocking solution, blocked for 1 hour at 37°C, and serum of different dilutions (1:10, 1:20, 1: 40 and 1:80) into ELISA wells, after incubation at 37°C for 1 hour, add 1:1000 diluted cell culture supernatant (including NDV-Nb5-HRP) to each well, after incubation at 37°C for 1 hour, directly add TMB After 10 minutes of color development, add 3mol H 2 SO 4 Stop color development, ELISA automatic microplate reader OD 45nm reading.
[0101] Figure 8 a and b are the binding levels of NDV-NP-Nb5-HRP and NDV-NP protein in the Newcastle disease virus antibody chicken serum, and the results show that the OD in the positive chicken serum cultured 450nm The value decreased, indicating that the anti-Newcastle disease virus positive chicken serum can well bl...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
molecular weight | aaaaa | aaaaa |
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com