Novel streptomyces trypsin GM2938 and heterologous expression thereof

A technology of GM2938 and trypsin, applied in the direction of enzymes, peptidases, hydrolytic enzymes, etc., can solve the problems of low enzyme yield, single component, and difficulty in heterologous expression, and achieve good application prospects and low collagenase activity.

Active Publication Date: 2019-10-18
SICHUAN UNIV
View PDF19 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Compared with trypsin derived from mammals, microbial fermentation production can obtain trypsin with a single component and similar applications. However, due to the long fermentation period of Streptomyces itself, the industrial fermentation is not easy to control, the yield is low, and the secondary metabolites in the later stage affect the subsequent production. Due to the shortcomings of enzyme purification and other shortcomings, researchers expect to use genetic engineering to obtain heterologous expression of Streptomyces trypsin
At present, the research on Streptomyces trypsin still has the following problems: (1) The development of trypsin-producing Streptomyces is insufficient, and there are few types of Streptomyces trypsin; (2) The content of GC in the Streptomyces trypsin gene is high, and it is difficult to achieve active Heterologous expression; (3) Enzyme yield is low, unable to meet industrial requirements
[0004] With the in-depth study of Streptomyces trypsin-encoding genes, some Streptomyces trypsins have been expressed in heterologous hosts; among them, Streptomyces freundii tryptase SFT is in E. coli The system is expressed in the form of zymogen, in Pichia The system is expressed in the form of a mature enzyme; the heterologous expression of Streptomyces griseus trypsin SGT has been studied more, and heterologous expression has been achieved in Escherichia coli, Streptomyces, Bacillus subtilis and Pichia pastoris respectively, but due to The GC content in the Streptomyces trypsin coding gene is high, and the protein itself contains three pairs of disulfide bonds, which makes its expression efficiency and yield low in most expression systems; therefore, choose a suitable signal peptide to construct a recombinant expression plasmid , which can provide guidance for the subsequent development and heterologous expression of other Streptomyces trypsins

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel streptomyces trypsin GM2938 and heterologous expression thereof
  • Novel streptomyces trypsin GM2938 and heterologous expression thereof
  • Novel streptomyces trypsin GM2938 and heterologous expression thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0013] Embodiment one: the acquisition of trypsin GM2938 gene

[0014] Genomic DNA of Streptomyces endophytic strain A249 was extracted, and the whole genome sequence was sequenced (completed by Beijing Novogene Biotech), combined with the obtained ORF reading frame, after reviewing relevant literature, comparing databases, and analyzing feasibility studies , a relatively novel trypsin GM2938 gene was selected, and its encoded amino acid sequence was 80.85% similar to the known trypsin SGT from Streptomyces griseus.

Embodiment 2

[0015] Example 2: Heterologous expression of GM2938 mature peptide gene

[0016] Design specific primers to amplify the mature peptide gene of GM2938, upstream primer (5'-AGGAGGCGCAACTCAAGCTTTTGCAGTCGTCGGCGGCACGCGCGCCG-3'), downstream primer (5'-AGCTTGCATGCCTGCAGGTCGACTCTCAGAGACCGGCGG CCGCTCTGGCT-3'), design plasmid pWB980 linearization primer, upstream primer (5'- AGCCAGAGCGGCCGCCGGTCTCTGAGAGTCGACCTGCAGGCATGCAAGCT-3'), downstream primers (5'-CGGCGCGCGTGCCGCCGACGACTGCAAAAGCTTGAGT TGCGCCTCCT-3'), obtained the amplified mature peptide gene of GM2938 and the linearized plasmid pWB980 fragment by PCR respectively, purified the recovered linearized plasmid and the target The gene fragments serve as primers for each other, and POE-PCR is carried out by ultra-high-fidelity enzymes, and the obtained plasmid polymer is transformed into the Bacillus subtilis engineering bacterium SCK6 to obtain the genetic engineering expression bacterium.

Embodiment 3

[0017] Embodiment three: Recombinant Bacillus subtilis engineered bacterium culture condition

[0018] Engineering bacteria containing recombinant plasmid pWB980-mt2938 B. subtilis SCK6 was inoculated in 100 mL of LB-resistant medium containing 1 µg / mL erythromycin and 50 µg / mL kanamycin, cultured on a shaker at 37°C overnight, and the next day, the above seed solution was inoculated at a 2% inoculum In the fermentation medium with the same resistance (medium composition: 15g / L soluble starch, 16 g / L tryptone, 32 g / L soybean peptone, 72 mM K 2 HPO 4 , 17 mM KH 2 PO 4 ; the initial pH value of the medium was 8.0), 34 °C, 200rpm shaker culture for 72 h; since the promoters carried by the plasmid pWB980 are all constitutive promoters, no additional inducer is needed to induce protein expression, and the target gene is pre-expressed A signal peptide is added to promote the extracellular expression of the protein, so it is necessary to collect the supernatant obtained after c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses streptomyces trypsin protein, heterologous expression carrier establishment and enzymatic properties of streptomyces trypsin, and belongs to the technical field of biology. Thefull-length gene GM2938 is obtained by digging whole-gene data of edophytic steptomyces A249, the full length of the gene is 759 bp, 253 amino acids are encoded, and the gene is expanded in vitro through a PCR. The heterologous cloning, expressing and purifying of the trypsin gene GM2938 in bacillus subtilis SCK6 are realized for the first time, and the representation of the enzymatic propertiesof the trypsin is conducted. The trypsin has the quite good enzymatic properties and has broad prospects in the leather process and food industrial application.

Description

technical field [0001] The invention relates to the technical field of heterologous expression of streptomyces trypsin GM2938 and its application. Background technique [0002] Streptomyces trypsin is an important member of the microbial trypsin family because of its good biological safety, controllable production quality, non-calcium ion activation, homology with mammalian bovine trypsin and enzymatic properties It is also similar to bovine trypsin and other advantages, and is widely used in pharmaceuticals, clinical diagnosis, food processing, leather processing, biochemical detection and other fields. [0003] Compared with trypsin derived from mammals, microbial fermentation production can obtain trypsin with a single component and similar applications. However, due to the long fermentation period of Streptomyces itself, the industrial fermentation is not easy to control, the yield is low, and the secondary metabolites in the later stage affect the subsequent production....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/76C12N15/75
CPCC12N9/6427C12N15/75C12Y304/21004
Inventor田永强王志宽龙秀锋
OwnerSICHUAN UNIV