A kind of non-integrated listeria vaccine and anti-tumor immune response method

A Listeria and vaccine technology, applied in anti-tumor drugs, bacterial antigen components, tumor-specific antigens, etc., can solve the problem of expression stability of antigen peptide expression, poor efficacy of Listeria vaccine, complex integration screening process, etc. problem, to achieve the effect of convenient operation, good expression of secreted protein, and high insertion efficiency

Active Publication Date: 2021-08-03
SUZHOU ROYALTECH MED CO LTD +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Alternatively, exogenous antigens can also be site-specifically integrated into non-essential regions of the LM genome (comK or tRNA Arg gene fragments) using the integrative vector pPL1 or pPL2, but this method requires antibiotics to maintain the strain selection[4]
[0006] To sum up, the listeria vaccines in the prior art are mainly expressed by integrating the antigen gene into the chromosome through homologous recombination. Although this method can avoid the introduction of new resistance genes, it has a long construction cycle and an integrated screening process. Complicated and other disadvantages
Although the non-integrated Listeria vaccine has the advantages of shorter construction cycle and simpler operation compared with the integrated Listeria vaccine, there are problems with the expression of antigenic peptides and expression stability, resulting in the use of the above method to construct Listeria. Vaccines have problems such as poor efficacy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of non-integrated listeria vaccine and anti-tumor immune response method
  • A kind of non-integrated listeria vaccine and anti-tumor immune response method
  • A kind of non-integrated listeria vaccine and anti-tumor immune response method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0127] Embodiment 1: Construction of the plasmid of attenuated listeria

[0128] Attenuated Listeria is used in the present disclosure as a carrier strain for vaccine preparation. Exemplary, what the present disclosure is used as the bacterial strain of vaccine adopts Lm 10403SΔactA (the construction method of aforementioned bacterial strain can exemplarily refer to the following literature: Shen H et.al., PNAS, 92 (9): 3987-91, 1995 ), the bacterium lacks the actA gene, so that the bacterium infecting the host cell cannot spread to adjacent cells through its unique actin tail, thereby greatly reducing its toxicity and pathogenicity. Compared with the wild-type strain Lm10403S (LD 50 1x10 4 ), LD of Lm-ΔactA 50 0.5-1x10 8 , proved to be highly attenuated. At the same time, the bacterium retains the ability of complete LLO to escape from lysosomes, enters the cytoplasm of host cells and proliferates rapidly, and expresses proteins to activate specific T cell immune respo...

Embodiment 2

[0138] Example 2: Construction of plasmids for attenuated Listeria for vaccines

[0139] To construct the Listeria vaccine plasmid, the antigen gene needs to be inserted into the plasmid vector, which has been designed with restriction sites, and the gene sequence of the target antigen is synthesized after the company optimizes the gene codon.

[0140] Optional, OVA 28 The codon optimization process is as follows:

[0141] Mouse OVA before corresponding codon optimization 28 Nucleotide sequence (SEQ ID NO: 7):

[0142] GATGAAGTCTCAGGCCTTGAGCAGCTTGAGAGTATAATCAACTTTGAAAAACTGACTGAATGGACCAGTTCTAATGTTATGGAA

[0143] OVA after corresponding codon optimization 28 Nucleotide sequence (SEQ ID NO:8):

[0144] GATGAAGTGAGCGGCCTGGAGCAGCTGGAGAGCATTATCAACTTCGAAAAACTGACCGAGTGGACCAGCAGCAATGTGATGGAA

[0145] The product was cloned into pAM401-phly-LLO using homologous recombination technology based on certain homologous sequences 1-28 -BamHI-LLO 22-523 -PstI-LLO 524-540 -PstI site o...

Embodiment 3

[0158] Example 3: Preparation of attenuated Listeria vaccine

[0159] The plasmids of the attenuated Listeria used for vaccines verified by sequencing were transformed into attenuated Listeria strains by electroporation technology, and single clones were selected for subsequent plasmid and expression verification.

[0160] The specific steps of the above-mentioned electrotransformation are as follows:

[0161] (1) Preparation of electroporation competent state

[0162] (i) The overnight cultured Listeria was transferred to 100-250ml brain-heart infusion broth (BHI) at a ratio of 1:50-1:200, and cultured with shaking at 37°C until OD 600 Value 0.2-0.25;

[0163] (ii) Add penicillin (PNG) to a final concentration of 10 μg / ml, and continue culturing for about two hours;

[0164] (iii) collect bacteria by high-speed centrifugation at 4°C for 5-10 minutes;

[0165] (iv) resuspend the bacterium with 200ml 10% glycerin, wash twice;

[0166] (v) Resuspend the bacteria with 45ml...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present disclosure relates to a non-integrated Listeria vaccine and anti-tumor immune response method. Specifically, the present disclosure relates to a recombinant nucleic acid molecule, a recombinant plasmid or a recombinant expression vector containing the recombinant nucleic acid molecule, a recombinant protein, and a recombinant Listeria. At the same time, the disclosure also relates to pharmaceutical compositions, vaccines and applications containing the above components, and further provides a method for slowly and persistently killing cells and a method for inducing an immune response in a subject. The plasmids employed in the present disclosure are very stable over multiple passages of Listeria. The vector obtained in the present disclosure can not be affected by the enzyme cleavage site on the heterologous antigen, is convenient to operate, has high insertion efficiency and accurate insertion, and greatly improves the expression of the non-integrated Listeria tumor vaccine antigen peptide, making it suitable for use in The effect on the anti-tumor immune response is more significant.

Description

technical field [0001] The present disclosure relates primarily to the field of biotechnology. Specifically, the present disclosure provides a non-integrated attenuated Listeria tumor or cancer vaccine, a method of increasing the expression of an antigenic peptide against a tumor or cancer, and a method of increasing an immune response against a tumor or cancer. Background technique [0002] Listeria monocytogenes (Listeria monocytogenes, Lm) is an important food-borne pathogen, which widely exists in fresh or ready-to-eat foods, and may cause severe Listeria infection to the elderly, children, pregnant women and immunosuppressed people. fungal disease. Listeria is a Gram-positive intracellular parasite that can survive and multiply in epithelial cells and phagocytes. In different stages of parasitism and reproduction, Lm has multiple virulence factors to assist it in the infection of the body and then play a pathogenic role. At present, many factors related to the pathoge...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/62C12N15/63C07K19/00C12N1/21A61K35/74A61K39/02A61P35/00
CPCC07K14/77C07K14/195A61K35/74A61K39/0208A61P35/00C07K2319/00A61K39/0011C12N15/74C07K2319/55C12N9/16C12Y301/04003C07K14/4748A61K39/385A61K2039/522A61K2039/523A61K2039/6068A61K38/00A61P17/00C07K14/32C07K2319/02C07K2319/21C07K2319/43A61K45/06A61K2039/585A61K2039/6081
Inventor代楠关剑赵勇刚
OwnerSUZHOU ROYALTECH MED CO LTD