Antiviral polypeptide and preparation method and application of antiviral polypeptide

An anti-virus and polypeptide technology, applied in the biological field, can solve the problems of difficulty in obtaining mutants with loss of function, no anti-viral effect polypeptide, short coding gene length, etc., to achieve plant virus immune defense and effective plant virus immune defense , the effect of reducing the amount of infection

Active Publication Date: 2019-12-03
CHINA AGRI UNIV
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, since the genes encoding secreted peptides of Arabidopsis are relatively short in length, it is difficult to obtain function-loss mutants through site-directed mutation, so there are still relatively few secreted peptides known to have disease-resistant functions.
In addition, previous studies have used bacteria, fungi or herbivorous insects as biological stress to stimulate the induction and disease resistance process of polypeptides. There is no report on the use of plant viruses to induce the secretion of polypeptides with antiviral effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antiviral polypeptide and preparation method and application of antiviral polypeptide
  • Antiviral polypeptide and preparation method and application of antiviral polypeptide
  • Antiviral polypeptide and preparation method and application of antiviral polypeptide

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Obtaining and expression vector construction of embodiment 1 AtVISP1 gene

[0053] (1) Acquisition of AtVISP1 gene

[0054] In this experiment, transcriptome sequencing was performed on Arabidopsis plants inoculated with cucumber mosaic virus (CMV) for one week, and the results were analyzed and it was found that the expression level of AT1G76960 was up-regulated to 3.58 times after inoculation with the virus (eg figure 1 shown), and then verify the result with realtime (such as figure 2 shown), the gene was named AtVISP1 gene, and the synthetic amplification primers were designed and synthesized according to the gene sequence.

[0055] According to the online website (http: / / www.cbs.dtu.dk / services / SignalP / ) to analyze the structural characteristics of AtVISP1 protein, it is shown that AtVISP1 contains 52 amino acids, of which 1-26 amino acids are part of the signal peptide (AtVISP1-S), The 27-52 amino acids behind are the mature peptide (AtVISP1-M) part, such as ...

Embodiment 2

[0060] Example 2 Detection of Antiviral Effect of Transient Expression of AtVISP1

[0061] (1) Transform the pMDC32-AtVISP1 vector constructed in Example 1 into Agrobacterium EHA105, using SEQ ID NO.18 (5'-AGGCGCGCCATGAAAAGTTCATCG GAGCTCC-3') and SEQ ID NO.20 (5'-GAGCTCCACCGCGGTGGC GGCCGC-3' ) Perform colony PCR identification and sequencing verification on the transformed strain, obtain a single positive Agrobacterium colony transformed with pMDC32-AtVISP1, and name it pMDC32-AtVISP1 strain. Inoculate the freshly activated pMDC32-AtVISP1 strain and the suppressor P19 strain into 3ml LB medium (containing 0.1mg / ml kanamycin and 0.025mg / ml rifampicin), and culture overnight at 28°C and 220rpm until OD 600 About 1.0, centrifuge at 4000rpm for 10min, discard the supernatant, and suspend the pellet in 2ml suspension buffer (10mM Morpholineethanesulfonic acid, 10mM MgCl 2 , 150μMAcetosyringone), measure OD 600 , adjust the OD of pMDC32-AtVISP1 strain with suspension buffer 600 0...

Embodiment 3

[0064] Example 3 Preparation of AtVISP1-M in Yeast

[0065] (1) Codon preference optimization of AtVISP1-M gene

[0066] Using the codon preference optimization program of the http: / / www.jcat.de / website, the nucleotide sequence encoding the mature peptide AtVISP1-M of the Arabidopsis AtVISP1 gene was optimized according to the yeast codon preference, and the optimized sequence For SEQ ID NO.21ATGTTGCC AGGTACTCCATATGGTGGTCCAGGTCCATATCCAAGATCTTATCCAGTTTGTTATCCACCATATTGTAGACCA, the AtVSP1-M gene fragment was synthesized by TSINGKE.

[0067] (2) Amplification of AtVISP1-M gene and construction of yeast expression vector

[0068] Using the synthetic fragment SEQ ID NO.21 as a template, with SEQ ID NO.22 (5'-ATAAGAATGCGGCCGCATGTTGCCAGGTACTCCATATGG-3', containing Not I site) and SEQ ID NO.23 (5'-CTAGTCTAGATGGTCTACAATA TGGTGGATAACAAAC-3', containing Xba I site) as a primer, PCR amplification with PrimeSTAR HSDNA polymerase (TaKaRa) to obtain a DNA fragment with a length of 81bp, th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an antiviral polypeptide and a preparation method and application of the antiviral polypeptide. The antiviral polypeptide contains any one amino acid sequence shown in SEQ IDNO.1-SEQ ID NO.8, the antiviral polypeptide gene is transformed into a plant and has a remarkable antiviral effect, and the antiviral polypeptide gene has a relatively strong antiviral effect on various viruses such as cucumber mosaic virus and barley stripe mosaic virus. The antiviral polypeptide is prepared by adopting a yeast expression system, the expression polypeptide is sprayed to a surfaceof the plant, and the virus infection amount of the plant is remarkably reduced. The antiviral polypeptide provided by the invention can be used for preventing and treating various virus infection ofplants; plant protection is carried out in production by utilizing a biological agent, and effective plant immune defense is realized, so that the use amount of pesticides is reduced, the plant quality is effectively improved, the yield of the plant is effectively increased, and the economic and social effects of crops are improved.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to an antiviral polypeptide and its preparation method and application. Background technique [0002] In the process of plant growth, facing the infection of various pathogenic microorganisms including fungi, bacteria, viruses, oomycetes and nematodes, plants have gradually evolved a set of defense mechanisms in order to survive for a long time. The immune mechanism of plants is mainly divided into two categories, one is broad-spectrum immunity (PAMP-triggered immunity, PTI) triggered by pathogen / microbe-related molecular patterns as elicitors; The specific recognition of toxic genes triggers immunity (Effectors-triggered immunity, ETI). In recent years, researchers have discovered that when plants are infected by pathogenic bacteria, the plants themselves will secrete some signaling molecules to the outside of the cells, triggering an immune response. This kind of secretory peptide f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29C12N15/81A01N47/44A01N37/46A01P1/00
CPCA01N37/46A01N47/44C07K14/415C12N15/81
Inventor王献兵朱非凡邹婧泽王颖于嘉林李大伟韩成贵张永亮
OwnerCHINA AGRI UNIV