Kit for rapid screening CTG repetition of high-risk gene TCF4 for Fuchs endothelial corneal dystrophy

A technology of kits and repeated regions, applied in the field of molecular biology diagnosis, can solve the problems of increasing treatment complexity and side effects

Inactive Publication Date: 2020-04-07
杭州方夏生物科技有限公司
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

If the subject has this high risk, the above treatment options should be avoided, because it will increase the complexity of future treatment and cause side effects after corneal transplantation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for rapid screening CTG repetition of high-risk gene TCF4 for Fuchs endothelial corneal dystrophy
  • Kit for rapid screening CTG repetition of high-risk gene TCF4 for Fuchs endothelial corneal dystrophy
  • Kit for rapid screening CTG repetition of high-risk gene TCF4 for Fuchs endothelial corneal dystrophy

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030]Example 1: Preparation of Fuchs corneal endothelial dystrophy rapid screening kit

[0031] 1. Primer design

[0032] A pair of PCR System I specific upstream primer TCF4-F1 and downstream primer TCF4-R1 were designed within 200 bp of the upstream 5' end and downstream 3' end of the CTG repeat sequence of the TCF4 gene to amplify the target genome including the CTG repeat region, 5' flanking region and 3' flanking region. The 5' flanking region is 149bp, the 3' flanking region is 30bp, and the length of the amplified fragment is (231+3xn)bp, where n represents the number of CTG repeats. The formula for calculating the CTG repeat number is: CTG repeat number=(PCR product length-231) / 3.

[0033] In the CTG repeat region of the TCF4 gene, the upstream primer TCF4-TGC was designed to specifically bind to the CTG repeat sequence 7 , and added human genome irrelevant sequence GTGGCATGCCAGTATTGAGACG at its 5' end, primer TCF4-T1 sequence is the added sequence GTGGCATGCCAGTATT...

Embodiment 2

[0040] Example 2: Normal CTG Repeat

[0041] Use a commercially available genomic DNA extraction kit to extract genomic DNA from the peripheral blood of the sample, with a concentration of at least 50 ng / μL, a 260 / 230 value greater than 2.0, and a 260 / 280 value greater than 1.8.

[0042] PCR system I reaction system prepared using the kit in Example 1: prepare 20 μL PCR system in a 200 μL PCR thin-walled tube.

[0043] The PCR reaction system is as follows:

[0044] 10×PCR buffer 2μL MgCl 2 (50mmol / L)

2μL dNTP (10mmol / L) 0.4μL TCF4-F1 (10μmol / L) 1μL TCF4-R1 (10μmol / L) 1μL DNA polymerase 0.1μL dna 1μL 2×PCR enhancer 10μL double distilled water Make up to 20 μL

[0045] The sequences of the primers TCF4-F1 and TCF4-R1 are respectively: SEQ ID NO: 1 and SEQ ID NO: 2.

[0046] PCR amplification program: 95°C pre-denaturation for 10 minutes; 95°C for 45 seconds → 57°C for 45 seconds → 72°C for 5 minutes, ...

Embodiment 3

[0049] Example 3: CTG repeat expansion

[0050] Use the kit in Example 1 to prepare PCR system I and PCR system II reaction systems: prepare 20 μL PCR system in a 200 μL PCR thin-walled tube.

[0051] The PCR reaction system is as follows:

[0052]

[0053] The sequence of primer TCF4-F2 is: SEQ ID NO: 6; the sequence of TCF4-R2 is: SEQ ID NO: 5; TCF4-TGC 7 The sequence is SEQ ID NO: 4; TCF4-GCA 7 The sequence is SEQ ID NO: 8; the sequence of TCF4-T1 is SEQ ID NO: 3; the sequence of TCF4-T2 is SEQ ID NO: 7.

[0054] PCR amplification program: 95°C pre-denaturation for 10 minutes; 97°C for 45 seconds→57°C for 45 seconds→72°C for 8 minutes, 40 cycles; 72°C for 10 minutes.

[0055] After the reaction, take 1 μL of PCR product, mix with 10 μL deionized formamide and 0.5 μL DNA internal standard 500LIZSize Standard, denature at 100°C for 5 minutes, and cool on ice. The mixture was analyzed for fragment length of PCR products with ABI 3500 Genetic Analyzer, the injection volt...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a detection method and a kit for rapid screening CTG repeated amplification of a high-risk gene TCF4 for Fuchs endothelial corneal dystrophy. The incidence rate of the Fuchs endothelial corneal dystrophy in people over 40 years of age in Europe and America is 5 percent, with about 70 percent of patients presenting CTG repeated amplification of the TCF4. Components in the kitinclude DNA polymerases, a reaction solution, an enhancer, dNTPs, a specific primer and a standard control. Through a CG-content PCR system, after fluorescence scanning of high-thermal-stability DNApolymerase amplification CTG repetition, an interval, in which CTG of a sample to be tested can be accurately distinguished from a standard substance. The kit provided by the invention is suitable forrapid screening whether the number of CTG repetitions of Fuchs endothelial corneal dystrophy sites TCF4 is normal or amplified individuals of all ages or with a large sample quantity, so that effective treatment strategies for various stages are proposed and made for high-risk people, and screening is performed on a corneal transplantation donor. The kit has the characteristics of accuracy, rapidness, high flux, small sample quantity and low cost.

Description

technical field [0001] The invention relates to the field of molecular biology diagnosis, in particular to a method and a kit for rapidly screening the number of CTG repeats in the third intron of the Fuchs corneal endothelial dystrophy risk gene TCF4. Background technique [0002] Fuchs endothelial corneal dystrophy (FECD), also known as guttate cornea, is a progressive damage to the corneal endothelium, thickening of the corneal elastic membrane, and deposition of extracellular matrix verrucous, eventually developing into corneal endothelial atrophy Hereditary corneal disease characterized by compensation. Fuchs endothelial dystrophy is the leading cause of corneal transplantation, affecting approximately 5% of Americans over the age of 40. The characteristic manifestations are the formation of corneal guttate warts, localized thickening of Descemet's membrane, and the decrease of corneal endothelial cell density and ion transport function. When the number of remaining c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/11C12Q1/686
CPCC12Q1/686C12Q2545/113
Inventor金赟懿
Owner杭州方夏生物科技有限公司