NAMPT lentiviral vector and biological agent and application thereof

A technology of lentiviral vector and lentivirus, which is applied in the direction of reverse transcription RNA virus, virus/bacteriophage, and the introduction of foreign genetic material by using vectors. Effect of NAD+ levels

Pending Publication Date: 2020-04-07
GUANGZHOU YIYANG BIO TECH CO LTD
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current new product in the field of anti-aging medicine is β-nicotinamide mononucleotide supplement, which needs to be supplemented continuously for a long time; while eNAMPT is a protease, which must be stored at low temperature, and the production and purification technology is complex and costly, requiring long-term repeated intravenous injection , it is not possible to promote the use of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • NAMPT lentiviral vector and biological agent and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] The construction of embodiment 1phNAMPT lentiviral vector

[0030] Chemically synthesize the hNAMPT gene, use the degeneracy of the gene code to replace certain bases, reduce the potential palindromic structure in the sequence to increase the titer of lentivirus production and expression in host cells, hNAMPT gene after base replacement The sequence is shown in SEQ ID NO:1. Then insert the hNAMPT gene sequence into the lentiviral vector pGIPZXbaI / MluI site to generate a new anti-aging lentiviral vector phNAMPT, as shown in the attached figure 1 shown. Finally, the gene sequence of the chemically synthesized and recombinant plasmid phNAMPT was analyzed by sequencing to be accurate.

[0031] SEQ ID NO: 1:

[0032]TCTAGACCTGTCCTCCGGCCCGAGATGAACCCCGCCGCCGAGGCCGAGTTCAACATCCTGCTGGCCACCGATAGCTACAAGGTGACCCACTACAAGCAGTACCCTCCCAACACCAGCAAGGTGTACAGCTACTTCGAGTGTCGCGAGAAGAAGACCGAGAACAGCAAGCTGAGGAAGGTGAAGTACGAAGAGACCGTGTTCTACGGCCTGCAGTACATCCTGAACAAGTACCTGAAGGGCAAGGTGGTGACCAAGGAGAA...

Embodiment 2

[0033] The packaging of embodiment 2NAMPT lentivirus

[0034] The lentiviral vector phNAMPT plasmid DNA and helper plasmid (pSPAX2.0 and pMD2G) DNA in Example 1 were co-transfected into 293T cells at an optimized ratio for lentiviral packaging. Among them, the pSPAX2.0 plasmid provides the reverse transcriptase necessary for lentiviral packaging, the Rev necessary for nucleoprotein and lentiviral RNA transport; the pMD2G plasmid provides the viral envelope VSV-G to ensure the broad host tropism of the lentivirus. In future tests, this pseudotropism will be further selected and optimized. This optimization can greatly improve the packaging efficiency of the lentivirus, ensuring that the phNAMPT lentivirus can infect skin cells or systemic tissue cells to the greatest extent when it is applied locally or systemically.

Embodiment 3

[0035] Purification of embodiment 3NAMPT lentivirus

[0036] After the 293T cells in Example 2 were cultured for 72 hours, the cell supernatant was collected and the titer of the lentivirus was measured, and the free host cell (293T cell) DNA / RNA was degraded by nuclease digestion, concentrated into a crude product by centrifugation, and used The titer of lentivirus was determined after resuspending the lentivirus particles in phosphate buffer solution; further purification was carried out by using ion exchange chromatography column, sucrose gradient centrifugation, etc. to remove impurity proteins and cell membrane fragments in the crude lentivirus product, and reach the clinical level for in vivo application. Then measure the lentivirus titer again, and calculate the lentivirus packaging efficiency and the yield of lentivirus in each concentration and purification step.

[0037] Among them, the ultracentrifugation method

[0038] 1. After sterilizing the Ultra-clearSW28 cen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an NAMPT lentiviral vector and a biological agent and application thereof. The NAMPT lentiviral vector comprises a human NAMPT gene, and the nucleotide sequence of the NAMPT gene is shown as SEQ ID NO: 1. The lentiviral preparation is expressed in in-vitro cultured cells and mouse skin local and whole-body application experiments and can improve the NAD+ level of cells. Theinvention further provides a related biological agent of the lentiviral vector for expressing the hNAMPT gene. After application, the expression quantity of NAMPT enzyme in individual cells is increased, and cells with high expression of NAMPT can secrete NAMPT (eNAMPT) to a circulatory system in the form of cyst corpuscles, so that the NAD+ level of cells in the whole body is increased, and theeffects of improving body motility and resisting aging are achieved.

Description

technical field [0001] The invention belongs to the technical field of gene therapy, and more specifically relates to a NAMPT lentiviral vector and its biological preparation and application. Background technique [0002] The field of anti-aging medicine is an important research hotspot in the field of biological sciences. Since David Sinclair, professor of genetics at Harvard Medical School, first confirmed the effect of β-nicotinamide mononucleotide in reversing aging and prolonging life in 2015, β- Nicotinamide mononucleotide has rapidly become a research hotspot in the field of biotechnology. In December 2018, Keio University in Japan discovered that β-nicotinamide mononucleotide can even regain the differentiation ability of inactivated senescent stem cells and successfully restore their cell activity. In June 2019, Shin-ichiro Imai's research group at Washington University School of Medicine published a paper entitled "Extracellular Vesicle-Contained eNAMPT Delays Agi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/867C12N15/54A61K48/00A61K38/45A61P39/00
CPCC12N15/86C12N9/1077C12Y204/02012A61K48/005A61K48/0008A61K38/45A61P39/00C12N2740/15043C12N2800/107
Inventor刘和平夏商周姜结根蒋桂瑾万阳夏黎明
OwnerGUANGZHOU YIYANG BIO TECH CO LTD