Recombinant protein for pepper mottle virus and preparation method thereof, polyclonal antibody and preparation method for polyclonal antibody, detection test kit and application for detection test kit
A pepper mottle virus, polyclonal antibody technology, applied in antiviral immunoglobulin, virus/phage, biochemical equipment and methods, etc., can solve the tedious electrophoresis UV observation process, pepper yield loss, host range, infection cycle Harm and other problems, to achieve the effect of reliable detection results, simple operation and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] A recombinant protein of pepper mottle virus (PepMoV) of the present invention: PepMoV CP protein, the DNA sequence expressing PepMoV CP protein is shown in SEQ ID NO.1, specifically:
[0036]atgagcagctcaagatcagatacattggatgctggagaggagaaaaaggaaaataaagaagtagccactgtgtccgatggaatgaaaaagaaggaggttgaatcaacacgcgattctgatgtgaatgcgggaactgtcggaacattcaccgttccaagaatcaaatcaatcactgagaagatgcgtatgccaaaacaaaagaaaaagggtgttctcaacttggctcatttacttgaatacaaaccaagccaagtcgacatatcgaatactcgttcaacccaggcacaatttgacaattggtatagtgaagttatgaaagcatacgatctacaagaggaggcaatgggtacagtgatgaatggcttaatggtttggtgcattgaaaatggcacgtccccaaacattagtggaacatggaccatgatggatggagacgaacaggtggaattcccattaaagcccgtgatagagaatgctaagccgacttttcggcagataatggcgcatttttctgatgtggctgaggcatatatagaaatgcgcaataagcaagaaccatacatgccacgatatggtttggttcgaaatttacgagacatgggtctggctcgatacgcatttgacttctatgaagtcacatcgcgtacgtcaacacgtgctcgcgaagcccatatccaaatgaaagcagcagcattgaaatctgctcaaacaaggctatttggattggatggtggcataggaacacaaggagaaaacacagagcgccacaccactgaagatgtgagccccgacatg...
Embodiment 2
[0066] An anti-capsicum mottle virus polyclonal antibody of the present invention is the PepMoV CP polyclonal antibody obtained by immunizing white rabbits with the PepMoV CP protein antigen of Example 1 as an immunogen. Its preparation method comprises the following steps:
[0067] Take 3~4mg of the purified PepMoV CP protein, pack it with dry ice, and send it to Hangzhou Huaan Biotechnology Co., Ltd. (two) immune and healthy big-eared white rabbits (two) to finally obtain polyclonal antibodies. The concentration of the obtained PepMoV CP polyclonal antibodies is 1780 μg / mL. The obtained PepMoV CP polyclonal antibody was used for sensitivity detection and specificity detection experiments.
experiment example 1
[0068] Experimental example 1: Sensitivity detection of PepMoV CP protein polyclonal antibody
[0069] In this experiment, the ID-ELISA method was used to detect the sensitivity of the PepMoV CP polyclonal antibody in Example 2. The specific experimental process is as follows:
[0070](1) Coating: Coat the PepMoV antigen with 10×PBST buffer: Dilute the PepMoV CP protein dilution (that is, the PepMoV antigen) at a concentration of 1000 μg / mL as described in Example 1, and use the antibody diluent (antibody diluent For 10×PBST buffer (pH 7.4) containing 1% BSA, serially dilute the PepMoV antigen by 200 times, 1000 times, 5000 times, 10000 times, 20000 times, 60000 times and 240000 times Add 100 μl of PepMoV antigen (diluted with antibody diluent) to each well of the microtiter plate sequentially, and incubate overnight at 4°C or 37°C for 2-3 hours. 10×PBST buffer (pH 7.4) containing 1% BSA was used as a negative control. The BSA is bovine serum albumin (Albumin from bovine se...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


