Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant protein for pepper mottle virus and preparation method thereof, polyclonal antibody and preparation method for polyclonal antibody, detection test kit and application for detection test kit

A pepper mottle virus, polyclonal antibody technology, applied in antiviral immunoglobulin, virus/phage, biochemical equipment and methods, etc., can solve the tedious electrophoresis UV observation process, pepper yield loss, host range, infection cycle Harm and other problems, to achieve the effect of reliable detection results, simple operation and high sensitivity

Pending Publication Date: 2020-05-19
HUNAN PLANT PROTECTION INST
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

PepMoV alone infects peppers, usually causing little yield loss; however, the symptoms of co-infection with plant viruses of Pepper mild mottle virus are more severe than those of these two viruses alone, and can Caused severe yield loss in pepper (Biological, physical and cytological properties of pepper mottlevirus-SNU1 and its RT-PCR detection. Plant Pathol J, 2006, 22(2): 155-160)
In 2016, the virus was detected on peppers in Hunan, Guangdong and Fujian provinces in my country, but the distribution, host range, infection cycle and harm of the virus in my country have not been reported so far. Therefore, the establishment of the virus The rapid detection technology system can provide technical means for monitoring the occurrence, distribution and harm of the virus, and can also provide a scientific basis for scientifically assessing the harm of the virus to agricultural production
[0003] The currently reported PepMoV detection method is mainly the RT-PCR method, which requires expensive instruments such as refrigerated high-speed centrifuges, PCR instruments, and gel imaging systems, as well as molecular biology reagents such as reverse transcriptase and high-fidelity Polymerase. At the same time, the detection process requires complex sample processing processes, such as total RNA extraction, reverse transcription; and the amplification process of more than 2 hours, and the tedious electrophoresis UV observation process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant protein for pepper mottle virus and preparation method thereof, polyclonal antibody and preparation method for polyclonal antibody, detection test kit and application for detection test kit
  • Recombinant protein for pepper mottle virus and preparation method thereof, polyclonal antibody and preparation method for polyclonal antibody, detection test kit and application for detection test kit
  • Recombinant protein for pepper mottle virus and preparation method thereof, polyclonal antibody and preparation method for polyclonal antibody, detection test kit and application for detection test kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] A recombinant protein of pepper mottle virus (PepMoV) of the present invention: PepMoV CP protein, the DNA sequence expressing PepMoV CP protein is shown in SEQ ID NO.1, specifically:

[0036]atgagcagctcaagatcagatacattggatgctggagaggagaaaaaggaaaataaagaagtagccactgtgtccgatggaatgaaaaagaaggaggttgaatcaacacgcgattctgatgtgaatgcgggaactgtcggaacattcaccgttccaagaatcaaatcaatcactgagaagatgcgtatgccaaaacaaaagaaaaagggtgttctcaacttggctcatttacttgaatacaaaccaagccaagtcgacatatcgaatactcgttcaacccaggcacaatttgacaattggtatagtgaagttatgaaagcatacgatctacaagaggaggcaatgggtacagtgatgaatggcttaatggtttggtgcattgaaaatggcacgtccccaaacattagtggaacatggaccatgatggatggagacgaacaggtggaattcccattaaagcccgtgatagagaatgctaagccgacttttcggcagataatggcgcatttttctgatgtggctgaggcatatatagaaatgcgcaataagcaagaaccatacatgccacgatatggtttggttcgaaatttacgagacatgggtctggctcgatacgcatttgacttctatgaagtcacatcgcgtacgtcaacacgtgctcgcgaagcccatatccaaatgaaagcagcagcattgaaatctgctcaaacaaggctatttggattggatggtggcataggaacacaaggagaaaacacagagcgccacaccactgaagatgtgagccccgacatg...

Embodiment 2

[0066] An anti-capsicum mottle virus polyclonal antibody of the present invention is the PepMoV CP polyclonal antibody obtained by immunizing white rabbits with the PepMoV CP protein antigen of Example 1 as an immunogen. Its preparation method comprises the following steps:

[0067] Take 3~4mg of the purified PepMoV CP protein, pack it with dry ice, and send it to Hangzhou Huaan Biotechnology Co., Ltd. (two) immune and healthy big-eared white rabbits (two) to finally obtain polyclonal antibodies. The concentration of the obtained PepMoV CP polyclonal antibodies is 1780 μg / mL. The obtained PepMoV CP polyclonal antibody was used for sensitivity detection and specificity detection experiments.

experiment example 1

[0068] Experimental example 1: Sensitivity detection of PepMoV CP protein polyclonal antibody

[0069] In this experiment, the ID-ELISA method was used to detect the sensitivity of the PepMoV CP polyclonal antibody in Example 2. The specific experimental process is as follows:

[0070](1) Coating: Coat the PepMoV antigen with 10×PBST buffer: Dilute the PepMoV CP protein dilution (that is, the PepMoV antigen) at a concentration of 1000 μg / mL as described in Example 1, and use the antibody diluent (antibody diluent For 10×PBST buffer (pH 7.4) containing 1% BSA, serially dilute the PepMoV antigen by 200 times, 1000 times, 5000 times, 10000 times, 20000 times, 60000 times and 240000 times Add 100 μl of PepMoV antigen (diluted with antibody diluent) to each well of the microtiter plate sequentially, and incubate overnight at 4°C or 37°C for 2-3 hours. 10×PBST buffer (pH 7.4) containing 1% BSA was used as a negative control. The BSA is bovine serum albumin (Albumin from bovine se...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant protein for pepper mottle virus and a preparation method thereof, a polyclonal antibody and a preparation method for the polyclonal antibody, a detection test kitand an application for the detection test kit. The recombinant protein for the pepper mottle virus is a PepMoV CP protein and is obtained through the following steps: with a PepMoV CP gene as a template, carrying out PCR amplification on the PepMoV CP gene so as to obtain an amplification product, and carrying out enzyme digestion, connection, conversion and separation. The polyclonal antibody isobtained by immunizing white rabbits with the PepMoV CP recombinant protein as an immunogen. The detection test kit composed of the polyclonal antibody can be applied to serological detection of thepepper mottle virus. The method provided by the invention can realize rapid and high-throughput detection, and has the advantages of rapidness, simplicity, convenience, strong specificity, high sensitivity and reliable detection result. The detection test kit provided by the invention can be used for rapid detection, prediction and forecast of the pepper mottle virus in production.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a recombinant protein of capsicum mottle virus and its preparation method, a polyclonal antibody and its preparation method, a detection kit and its application. Background technique [0002] pepper mottle virus ( Pepper mottle virus, PepMoV) is a member of the family Potatoviridae ( Potyviridae ) Potatovirus ( Potyvirus ), can be transmitted mechanically or by the vector aphid, and can infect a variety of important Solanaceae crops. Infestation of pepper usually results in yellowing of pepper leaves, and can also cause necrosis of leaf veins or necrosis of leaf buds or flower leaves in some pepper varieties (Isolation and characterization of pepper mottle virus infecting tomato in Korea. Plant Pathol J, 2008, 24(2): 152-158). PepMoV alone infects peppers, usually causing little yield loss; however, the symptoms of co-infection with plant viruses of Pepper mild mottle virus are...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/08C12N15/70C07K16/10G01N33/569
CPCC07K14/005C07K16/10C12N15/70C12N2770/34022G01N33/56983
Inventor 刘勇张松柏张德咏罗香文彭静张宇张卓
Owner HUNAN PLANT PROTECTION INST