Unlock instant, AI-driven research and patent intelligence for your innovation.

Sequencing library construction method and kit for pathogenic microorganism detection

A technology of pathogenic microorganisms and sequencing libraries, which is applied in the field of sequencing library construction methods and kits for pathogenic microorganism detection, can solve the problems of low microbial content, error-prone, and difficult to meet the detection initial quantity requirements, etc.

Active Publication Date: 2020-05-22
VAZYME BIOTECH NANJING
View PDF7 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since patient samples come from relatively complex samples such as cerebrospinal fluid, pleural effusion, alveolar lavage fluid, blood, etc., poor preservation of samples can easily lead to nucleic acid degradation, low extraction quality, low microbial content, and it is often difficult to meet the detection threshold requirements; In addition, DNA and RNA are operated separately, and the process is long and error-prone. The key step for simultaneous DNA and RNA library construction is the transposase fragmentation step. The efficiency of Tn5 transposase fragmentation of cDNA hybrid strands is low. The inactivation of transposase is not complete, and the transposase sticks to the DNA, affecting the subsequent amplification, which will have a great impact on the quality and speed of library construction.
Errors in library construction will lead to incomplete library and incomplete information, which will eventually lead to low efficiency of pathogen detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sequencing library construction method and kit for pathogenic microorganism detection
  • Sequencing library construction method and kit for pathogenic microorganism detection
  • Sequencing library construction method and kit for pathogenic microorganism detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0078] Embodiment 1: the acquisition of mutant Tn5 transposase

[0079] The preparation method of the mutant Tn5 transposase whose amino acid sequence is shown in SEQ ID NO.1 comprises the following steps: Utilize the method of gene synthesis to synthesize the primer sequence comprising the site to be mutated and the substituted base as follows:

[0080] D24-f: CGGCGCTGGGTGAGCCTCGCCGTA

[0081] D24-r: TACGGCGAGGCTCACCCCAGCGCCG

[0082] A97-f: GCCATTGAGGAAACCACCT;

[0083] A97-r: AGGTGGTTTCCTCAATGGC;

[0084] K160-f: TGCGGATGAAAGGGAGAGTGGCAA

[0085] K160-r: TTGCCACTCTCCCTTTCATCCGC

[0086] C326-f: CGGATCGACGAGTTCCATA;

[0087] C326-r: TATGGAACTCGTCGATCCG;

[0088] Phanta Max Super-Fidelity DNA Polymerase (produced by Nanjing Nuoweizan Biotechnology Co., Ltd., Vazyme, product number P505) was used as the DNA polymerase. The amplification conditions were 95°C for 30s; 95°C for 15s; 60°C for 15s; 72°C for 30s-3min; 72°C for 5min; a total of 30 cycles. After amplification,...

Embodiment 2

[0090] Embodiment 2: Detect the stability of sample preservation solution

[0091] The sample preservation solution in the present invention includes: Tris-HCl 100mM, pH=8.0, guanidine hydrochloride 3M, cobalt chloride 2mM, EDTA.2Na 0.2M, Triton X-100 1%, sodium deoxycholate 1mM.

[0092] Pharyngeal swab specimens of normal people were put into the sample preservation solution of the present invention and the sample preservation solution sold in the market, one group was stored at 4°C for 24 hours, and the other group was stored at 56°C for 1 hour, and then RNA was extracted by conventional experimental methods. get as image 3 and Figure 4 the results shown, image 3 It is stored at 4°C for 24 hours, the first 3 holes are placed in the sample preservation solution of the present invention, and the last 3 holes are placed in the sample preservation solution sold in the market; Figure 4 It was stored at 56°C for 1 hour, the first 2 wells were placed in the sample preserva...

Embodiment 3

[0094] Example 3: DNA / RNA rapid common library construction based on mutant Tn5 transposase

[0095]The core of this example lies in the rapid joint library construction of DNA / RNA. The reverse transcriptase used in this example is HiScript III Reverse Transcriptase (Product No. R302) from Nanjing Novizan Biotechnology Co., Ltd.; the reverse transcription reaction buffer used is The buffer solution attached to HiScript III ReverseTranscriptase of Nanjing Novizan Biotechnology Co., Ltd.; the reverse transcription primer used is Oligo(dT) 20 Mixture of VN and random primers; Tn5 transposase is the mutant of D24E, D97E, K160R and E326D simultaneous mutation, namely: TTE-plus. The breaking buffer is the TTBL component in the TruePrep DNA library Prep Kit V2 for Illumina kit of Nanjing Nuoweizan Biotechnology Co., Ltd., that is, TruePrep Tagment Buffer L; breaking stop buffer 5×TS-plus, containing: 2.5% BSA, 1% Tween-20, 0.5% SDS, 25mM DTT; RNA purification magnetic beads are VAHT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a sequencing library construction method and kit for pathogenic microorganism detection. The method comprises: (1) putting an extracted sample into a sample preservation solution, carrying out DNA / RNA co-extraction, and removing host rRNA; (2) adding reverse transcriptase to enable RNA in the sample to be subjected to reverse transcription to form RNA / cDNA composite doublestrands; (3) directly adding mutant Tn5 transposase and a breaking buffer solution into a mixture of the reverse transcription product cDNA / RNA composite double strand and a DNA double strand for fragmentation, and after the fragmentation is finished, carrying out a termination reaction by using a termination reaction solution 5*TS-plus; (3) adding an amplification buffer solution and a strand displacement and amplification enzyme mixture, and carrying out PCR amplification; and (4) carrying out magnetic bead purification to obtain a sequencing library of the original DNA / RNA. According to themethod, library building steps are greatly reduced, the library building time is shortened, the requirement on the initial quantity of samples is reduced, and the library output and offline data quality are improved.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a sequencing library construction method and kit for pathogenic microorganism detection. Background technique [0002] Pathogenic microorganisms refer to microorganisms, or pathogens, that can invade the human body and cause infection or even infectious disease. Among pathogens, bacteria and viruses are the most harmful. Pathogenic microorganisms include prions, parasites (protozoa, worms, medical insects), fungi, bacteria, spirochetes, mycoplasma, rickettsia, chlamydia, and viruses. [0003] Infections and infectious diseases caused by pathogenic microorganisms are one of the most common clinical diseases, accounting for 50% of human diseases. Variability, pathogenic microorganisms present a trend of diversification and complexity, which seriously threatens human health. Infectious diseases caused by pathogenic microorganisms often develop rapidly in the course of disease, and th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C40B50/06C12N1/04
CPCC12N1/04C40B50/06
Inventor 聂俊伟韩锦雄江明扬张力军瞿志鹏吴恒
Owner VAZYME BIOTECH NANJING