Susceptible fungal gene LrWRKY-S1 of lily and application thereof

A technology of lrwrky-s1 and fungi, which is applied in the fields of application, genetic engineering, plant genetic improvement, etc., and achieves the effect of good application prospects

Inactive Publication Date: 2020-06-05
YANGTZE NORMAL UNIVERSITY
View PDF9 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are few reports on the susceptibility genes of fungi in Lily of Minjiang River

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Susceptible fungal gene LrWRKY-S1 of lily and application thereof
  • Susceptible fungal gene LrWRKY-S1 of lily and application thereof
  • Susceptible fungal gene LrWRKY-S1 of lily and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Cloning and Sequence Analysis of LrWRKY-S1 Gene of Lilium Minjiang

[0025] Using the leaves of Lily of the Minjiang River as the material, using TRIzol TM Plus RNA Purification Kit (12183555, Invitrogen TM ), extract total RNA according to the instructions, use DNase I (18047019, InvitrogenTM) to remove residual trace DNA, and use a spectrophotometer to measure the concentration of RNA for future use.

[0026] About 2.0 μg of total RNA from leaves of Lilium Minjiang was taken, and the first-strand cDNA was synthesized according to the instructions of PrimeScript II first-strand cDNA synthesis kit (6210A, Takara).

[0027] PCR amplification system: 2xfast pfu master Max 10ul, forward primer (LrWRKY-S1-1-F, 10μM) 1μL, reverse primer (LrWRKY-S1-R, 10μM) 1μL, template (cDNA) 1μL, sterile ddH 2 O to make up to 20 μL.

[0028] The forward and reverse primers are:

[0029] LrWRKY-S1-F:5'-GTCCGAATATCATGGACGGAG-3'

[0030] LrWRKY-S1-R:5'-CTACAACATTTAAACGAAGAAGGCA...

Embodiment 2

[0035] Example 2 Construction of GFP fusion expression vector and analysis of subcellular localization

[0036] (1) Construction of pTF101-P35S::GFP-LrWRKY-S1 expression vector

[0037] According to the pTF101-GFP vector sequence and the full-length sequence of the LrWRKY-S1 gene (SEQ ID NO.1), a forward primer (LrWRKY-S1-inf-F1) and a reverse primer (LrWRKY-S1-inf-R1) were designed. Using the TA-ligated positive clone plasmid in Example 1 as a template, PCR amplification of the LrWRKY-S1 gene fragment was performed.

[0038] The primer sequences are as follows:

[0039] LrWRKY-S1-inf-F1:

[0040] 5'- ATGGACGGAGGCTCTGGGACAG-3'

[0041] LrWRKY-S1-inf-R1:

[0042] 5' TTAAACGAAGAAGGCAGAGGCATCG-3'

[0043] The underline is the In-fusion cloning vector linker sequence, and the bold sequence is the restriction site.

[0044] PCR reaction system: high-fidelity amplification enzyme PrimeSTARHS (R010 A, TaKaRa) 0.5μL, 5xPrimeSTARBuffer (Mg 2+ Plus) 10 μL, forward primer (10 ...

Embodiment 3

[0054] Example 3 LrWRKY-S1 Gene Overexpression Vector Construction and Genetic Transformation of Arabidopsis

[0055] (1) Construction of pBI121-P35S::LrWRKY-S1 overexpression vector

[0056] According to the pBI121 vector sequence and LrWRKY-S1 gene sequence (SEQ ID NO.1), design primers LrWRKY-S1-inf-F2 and LrWRKY-S1-inf-R2, and introduce seamless cloning (In-fusion) vector adapter sequence into the primers and enzyme cleavage site sequences. The specific amplification of the LrWRKY-S1 gene fragment was performed using the TA-ligated positive clone plasmid in Example 1 as a template.

[0057] The primer sequences are as follows:

[0058] LrWRKY-S1-inf-F2:

[0059] 5'- GGACTCTAGAGGATCC GTCCGAATATCATGGACGGAG-3'

[0060]LrWRKY-S1-inf-R2:

[0061] 5'- GATCGGGGAAATTCGAGCTC CTACAACATTTAAACGAAGAAGGCAG-3'

[0062] Among them, the underline is the linker sequence of the In-fusion cloning vector.

[0063] The PCR reaction system is: high-fidelity amplification enzyme PrimeS...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a susceptible fungal gene LrWRKY-S1 of lily and application thereof. A nucleotide sequence of the LrWRKY-S1 gene is shown by SEQ ID NO.1 and an amino acid sequence coded thereby is shown by SEQ ID NO.2. Biological functions of the protein are studied by a bacteriostasis experiment. Experimental results show the protein makes plants more susceptible to pathogenic fungi suchas Botrytis cinerea, fusarium oxysporum and Colletotrichum orbiculare. As found as well, the LrWRKY-S1 gene has a low expression level in lilium regale with high resistance, and a homologous gene thereof has high expression levels in lilium davidii, lilium longifolorum and lilium lancifolium with important economic values. The gene and the application thereof provide an efficient susceptible genefor genetic engineering reconstruction, lays a foundation for further cultivation of fungus-resistant / susceptible lily or new materials or new species of other plants, can provide theoretical and technical support for later application of the gene in plant genetic improvement, broadens ideas for prevention and control of plant diseases and has very extensive application values.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a lily susceptibility fungal gene LrWRKY-S1 and its application. Background technique [0002] In agricultural production, plant diseases, especially fungal diseases, have always been an important factor limiting the improvement of crop yields. Interactions between fungal pathogens and plant hosts can be classified as "resistance" or "susceptibility" depending on how the fungal infection progresses, involving different host cell genes and mechanisms regulating the expression of said host cell genes. In resistance, organisms control fungal attack by producing antifungal proteins (AFPs), antifungal peptides or compounds. Antifungal proteins are evolutionarily conserved components of the innate immune response and are major effector molecules. Antifungal proteins participate in the constitutional resistance or induced resistance mechanism of organisms...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00A01H6/82A01H6/20
CPCC07K14/415C12N15/8218C12N15/8282
Inventor符勇耀杨利平吴涵徐文姬
OwnerYANGTZE NORMAL UNIVERSITY