Solution for prolonging opening time of fertilization holes of fish eggs and method for introducing foreign genes by using fertilization holes
A technology of open time and foreign genes, applied in other methods of inserting foreign genetic materials, medical preparations containing active ingredients, pharmaceutical formulas, etc., can solve the problems of high probability of degradation, instability, and high egg mortality. Achieve the effect of high positive ratio, high stability and low technical requirements
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Taking tilapia as the experimental object, the introduced gene is an artificially designed polylysine gene, as shown in SEQ ID No.1, and the specific sequence is as follows:
[0040] ATGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGcaccaccaccaccaccacTGATGATAAGAGTGA. After artificially synthesizing this sequence, it was cloned into the pcDNA3.1 expression vector.
[0041] According to the sequence of pcDNA3.1 expression vector, two pairs of primers were designed. The first step reaction uses primers (SEQ ID No. 2: gcttagggttaggcgttttgcgc; SEQ ID No: 3: gcgcaaaacgcctaaccctaagc, the amplified product includes the CMV promoter to the downstream of the tailed sequence) for amplification. The reaction system is 50 μl, including 25 μl of 2×Mastermix, 5 μl of primers, 18 μl of ultrapure water, and 2 μl of mutant genomic DNA. The amplification program was: pre-denaturation at 95°C for 2 min, 33 cycles (denaturation at 95°C for 30 s, ann...
Embodiment 2
[0048] Taking carp as the experimental object, the gene introduced is a small anti-seating element DANA of zebrafish, as shown in SEQ ID No.8, and the specific nucleotide sequence is as follows:
[0049] ggcgacacagtggcgcagtaggtagcacgattgcctcacagcaagaagatcgctggttcgagtctcggctgggtcagttggcatttctgtgtggagtttgcatgttctcgccgtgttcgcatgggtttcctccgggtgctctggtttcccccacagtccaaagacatgcggtacaagtgaattgggtaggctaaattgttcgtagtgtatgtgtgtgaatgggagtgtattggcatttcccattgatgggttgcagctggaagggcatccgctgcgtaaaagatatgctggaaaagttggtggttcattgggctgtggcgaccccagaataataaagggactaagccaaaaagaaaaaa。
[0050] Construct the target gene into pEB-GFP(T 2 A) PURO on the lentiviral expression vector. Transform with E coli XL1-BLUEMRF' competent cells, select positive clones, shake the bacteria, extract the plasmid, and linearize with the restriction endonuclease SphI.
[0051] Selectively mature carp, one male and one female, were injected with chorionic gonadotropin 40mg / kg, and cultured in a water tank at room temperatur...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



