Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Solution for prolonging opening time of fertilization holes of fish eggs and method for introducing foreign genes by using fertilization holes

A technology of open time and foreign genes, applied in other methods of inserting foreign genetic materials, medical preparations containing active ingredients, pharmaceutical formulas, etc., can solve the problems of high probability of degradation, instability, and high egg mortality. Achieve the effect of high positive ratio, high stability and low technical requirements

Active Publication Date: 2020-06-19
FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The disadvantages of microinjection are: the integrity of the shell of fish eggs is damaged, and the egg mortality rate after microinjection is relatively high; microinjection has strict requirements on the injection time, and must be injected during the period of two to sixteen cells after fertilization, otherwise it will be easy Chimeras are produced; microinjection efficiency is not high, and the number of fish eggs that can be operated at one time is small; technical difficulty is high for injectors
[0004] Disadvantages of the sperm-carrying method: the combination efficiency of sperm and foreign DNA is not high, and it is unstable, which will cause instability in the positive ratio of transgenic fish in different batches
Exogenous DNA has a higher probability of being degraded after being introduced into the fertilized egg by sperm, and it is not easy to integrate into the genome

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Solution for prolonging opening time of fertilization holes of fish eggs and method for introducing foreign genes by using fertilization holes
  • Solution for prolonging opening time of fertilization holes of fish eggs and method for introducing foreign genes by using fertilization holes
  • Solution for prolonging opening time of fertilization holes of fish eggs and method for introducing foreign genes by using fertilization holes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Taking tilapia as the experimental object, the introduced gene is an artificially designed polylysine gene, as shown in SEQ ID No.1, and the specific sequence is as follows:

[0040] ATGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGcaccaccaccaccaccacTGATGATAAGAGTGA. After artificially synthesizing this sequence, it was cloned into the pcDNA3.1 expression vector.

[0041] According to the sequence of pcDNA3.1 expression vector, two pairs of primers were designed. The first step reaction uses primers (SEQ ID No. 2: gcttagggttaggcgttttgcgc; SEQ ID No: 3: gcgcaaaacgcctaaccctaagc, the amplified product includes the CMV promoter to the downstream of the tailed sequence) for amplification. The reaction system is 50 μl, including 25 μl of 2×Mastermix, 5 μl of primers, 18 μl of ultrapure water, and 2 μl of mutant genomic DNA. The amplification program was: pre-denaturation at 95°C for 2 min, 33 cycles (denaturation at 95°C for 30 s, ann...

Embodiment 2

[0048] Taking carp as the experimental object, the gene introduced is a small anti-seating element DANA of zebrafish, as shown in SEQ ID No.8, and the specific nucleotide sequence is as follows:

[0049] ggcgacacagtggcgcagtaggtagcacgattgcctcacagcaagaagatcgctggttcgagtctcggctgggtcagttggcatttctgtgtggagtttgcatgttctcgccgtgttcgcatgggtttcctccgggtgctctggtttcccccacagtccaaagacatgcggtacaagtgaattgggtaggctaaattgttcgtagtgtatgtgtgtgaatgggagtgtattggcatttcccattgatgggttgcagctggaagggcatccgctgcgtaaaagatatgctggaaaagttggtggttcattgggctgtggcgaccccagaataataaagggactaagccaaaaagaaaaaa。

[0050] Construct the target gene into pEB-GFP(T 2 A) PURO on the lentiviral expression vector. Transform with E coli XL1-BLUEMRF' competent cells, select positive clones, shake the bacteria, extract the plasmid, and linearize with the restriction endonuclease SphI.

[0051] Selectively mature carp, one male and one female, were injected with chorionic gonadotropin 40mg / kg, and cultured in a water tank at room temperatur...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a solution for prolonging the opening time of fertilization holes of fish eggs and a method for introducing foreign genes by using the fertilization holes, and belongs to the technical field of research and production of transgenic fish. The solution uses water as a solvent, and each liter of the solution comprises 6 g of sodium chloride, 0.15g of potassium chloride, 0.1g ofcalcium chloride, 0.1g of sodium bicarbonate, 0.1g of sodium dihydrogen phosphate and 1g of glucose. The solution can prolong the opening time of the fertilization pores of the fish eggs, so that theforeign genes can conveniently directly enter the fish eggs.

Description

technical field [0001] The invention belongs to the technical field of transgenic fish research and production, and in particular relates to a solution for prolonging the opening time of fertilization pores of fish eggs and a method for introducing exogenous genes through the fertilization pores. Background technique [0002] Now common introduction techniques include: microinjection, sperm carrying method and point perforation method. Among them, microinjection is the most commonly used and relatively effective method of gene transfer. Microinjection is the first transgenic method, which has been widely used and achieved good results. The method is to insert a certain amount of exogenous gene into the fertilized egg with a glass needle with a diameter of several micrometers under a microscope, and the injected fertilized egg develops into fry in normal saline at room temperature. [0003] The disadvantages of microinjection are: the integrity of the shell of fish eggs is ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/88
CPCC12N15/88A61K33/14A61P15/08A61K33/10A61K31/7004
Inventor 曹哲明强俊徐跑
Owner FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com