Method for efficiently expressing ORF2 (Open Reading Frame 2) gene of goose astrovirus soluble capsid precursor, and application of method

An astrovirus and capsid protein technology, which is applied in the field of the ORF2 gene that efficiently expresses the soluble capsid protein of goose astrovirus, can solve the problems of lack of preventive and therapeutic products, difficulty in controlling the source of infection, and prolonging the emptying time, etc. To achieve the effect of cost reduction, high protein activity and good protection

Active Publication Date: 2020-07-31
ZHEJIANG VBIOSCI INC +1
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Infected goslings continue to excrete the virus through defecation and other channels, and it is difficult to control the source of infection through fecal-oral transmission.
GAstV has caused huge economic losses to the poultry industry
[0003] The main methods of prevention and control of GAstV in the existing technology are still prolonging the time of vacant houses, disinfection and isolation, and there are no related preventive and therapeutic products

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for efficiently expressing ORF2 (Open Reading Frame 2) gene of goose astrovirus soluble capsid precursor, and application of method
  • Method for efficiently expressing ORF2 (Open Reading Frame 2) gene of goose astrovirus soluble capsid precursor, and application of method
  • Method for efficiently expressing ORF2 (Open Reading Frame 2) gene of goose astrovirus soluble capsid precursor, and application of method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Expression of Goose Astrovirus ORF2 Gene in Escherichia coli Prokaryotic Expression Vector

[0030] 1. Synthesis of ORF2 gene

[0031] Referring to the ORF2 gene sequence of the Goose Astrovirus strain, the sequence was optimized by comprehensive factors, such as the codon bias of Escherichia coli. Artificially synthesized ORF2 gene, as shown in SEQ ID NO.1, was connected into the vector to obtain pUC57-ORF2.

[0032] 2. Design and PCR amplification of cloned genes

[0033] The ORF2 gene was divided into two segments of capsid protein 39nt-406nt and spike protein 394nt-665nt according to the different encoded proteins for vector construction and expression respectively.

[0034] Primers were designed according to the nucleotide sequence for gene amplification. The primer sequence was Seg1-F CGCGGATCCCCAGAAACTGCCGATGAAAGCTGAAC; Seg1-R AAAAGGAAAAGCGGCCGCGCCCTGACCAGTGGTGTTAACGTTC was used to amplify the capsid protein of 368 amino acids; Seg2-F CGCGGATCCATGCAGGTGACCCCGAG...

Embodiment 2

[0051] Construction of Astrovirus recombinant Escherichia coli expressing cap protein and spike protein

[0052] 1. Construction and expression of recombinant strains

[0053] (1) Transform the correctly identified recombinant plasmids pET28a-cap and pET28a-spike into Escherichia coli BL21(DE3)pLysS, respectively, to construct recombinant expression strains BL21(DE3)pLysS(pET28a-cap) and BL21(DE3)pLysS(pET28a- spike).

[0054] (2) After activating BL21(DE3)pLysS(pET28a-cap) and BL21(DE3)pLysS(pET28a-spike) respectively, they were inoculated into liquid TB (Kan, 50μg / ml) medium at a ratio of 1:100, Place in a shaker at 37°C for about 3 hours, add IPTG to a final concentration of 0.5mM, centrifuge the bacterial solution after overnight induction, remove the TB supernatant, and resuspend the remaining bacterial cells in PBS for ultrasonic disruption.

[0055] (3) The supernatant and the precipitate were separated by centrifugation of the sonicated bacteria, and the solubility w...

Embodiment 3

[0063] Affinity chromatography purification of cap and spike proteins

[0064] The broken supernatant of Escherichia coli periplasm was purified by Ni-NTA chromatographic column. 2 O slowly flows through the nickel column, 20% ethanol solution flows out, and the column is washed repeatedly; (2) Equilibrium nickel column: 20mL Binding Buffer balance column; (3) Sample loading: add 10mL cap protein or spike protein to the nickel column , repeated loading 3 times; (4) washing protein: 50mL Washing Buffer continuously washes miscellaneous protein; (5) elution protein: 10mL Elution Buffer elutes the target protein; the purified sample is identified by SDS-PAGE and Western Blot, cap protein The purity of spike protein can reach more than 90% after affinity chromatography purification. The results of Western blot identification are as follows: image 3 Lane 1 and Lane 2 show: the purified cap and spike proteins were subjected to Western blot with his antibody, which showed that the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for efficiently expressing an ORF2 (Open Reading Frame 2) gene of a goose astrovirus soluble capsid precursor, and application of the method, and belongs to the fieldof veterinary biological products. The ORF2 gene of the goose astrovirus is divided into two-segment expression according to the difference of gene sequence functions, and expression products are independently capsid precursor (short for cap) and capsid spike (short for spike). Two segments of proteins segmented according to functional zones can be expressed by escherichia coli, baculovirus and aCHO (Chinese Hamster Ovary) expression system. Through a purification method, the capsid precursor expression protein and the capsid spike expression protein of the goose astrovirus can be obtained.The expressed capsid precursor and capsid spike can be used for preparing a subunit vaccine and an egg yolk antibody of the goose astrovirus. The subunit vaccine and the egg yolk antibody prepared bythe method disclosed by the invention have a good immune effect and treatment effect, can be used for preventing diseases caused by the goose astrovirus and have the advantages of being in low in production cost, simple in operation and good in biological safety.

Description

technical field [0001] The invention relates to the technical field of veterinary biological products, in particular to a method for highly expressing the ORF2 gene of goose astrovirus soluble capsid protein and its application. Background technique [0002] Goose Astrovirus (GAstV) is an astrovirus that causes highly fatal visceral gout in goslings less than three weeks old. The characteristics of its onset are: after the geese are infected with GAstV, the tissues, organs, leg muscles and joints are covered with a large amount of urate deposits as the main feature. The goslings within are highly infectious. Recovered geese are prone to immunosuppression after infection. Its main clinical symptoms include depression, loss of appetite, diarrhea, poor growth, and can also lead to diseases such as hepatitis and nephritis. Necropsy of dead goslings revealed renal tubular epithelial cell damage, severe urate deposition in the heart, liver, lungs, leg muscles, pectoral muscles,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N15/66C12N15/40C07K14/08C07K1/22A61K39/12A61K39/42A61P31/14C07K16/10C07K16/02
CPCC12N15/70C12N15/66C07K14/005A61K39/12A61P31/14C07K16/10C07K16/02C12N2800/22C12N2770/12022C12N2770/12051C12N2770/12034A61K2039/552A61K2039/505
Inventor张凌云张博谢田田闫召璐赵远菲耿彦杰郑杰马宁宁
OwnerZHEJIANG VBIOSCI INC