Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Indirect ELISA antibody detection kit for African swine fever virus p54 recombinant protein, and preparation method thereof

An African swine fever virus and antibody detection technology, which is applied in the field of African swine fever virus antibody detection and virus detection, can solve problems such as the decline in the accuracy of detection reagents, achieve the effects of simple purification, simple production, and avoid the incidence of cross-reactions

Inactive Publication Date: 2020-08-07
HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
View PDF8 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the reagents for detecting ASFV antibodies at all levels developed with the p54 protein as the antigen, unexpected detection cross-reactions occurred, which reduced the accuracy of the positive detection of the detection reagents

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Indirect ELISA antibody detection kit for African swine fever virus p54 recombinant protein, and preparation method thereof
  • Indirect ELISA antibody detection kit for African swine fever virus p54 recombinant protein, and preparation method thereof
  • Indirect ELISA antibody detection kit for African swine fever virus p54 recombinant protein, and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Embodiment 1: Preparation of recombinant soluble protein of African swine fever virus p54

[0043] 1) Amplification of the E183L gene: According to the E183L gene sequence of the ASFV Pig / HLJ / 2018 strain (GeneBank accession number: MK333180.1) determined by the Harbin Veterinary Research Institute of the Chinese Academy of Agricultural Sciences, the specificity of the full-length amplification of the E183L gene was designed using Oligo7 software Primers, the upstream primer used is F:TTAAGAAGGAGATATACATATGTCTTCAAGAAAG (SEQ.NO1); the downstream primer is R:TCAGTGGTGGTGGTGGTGGTGCTCGAGGGATCCACGCGGAACCAGCAAGGAGTTTTTCTAG (SEQ.NO 2). Extract ASFV genomic DNA, utilize PCR method to amplify E183L gene fragment (see figure 1). The PCR amplification system was as follows: 5×HF buffer, 10 μL; upstream primer (10 μmol / L), 2.5 μL; downstream primer (10 μmol / L), 2.5 μL; 100% DMSO, 1.5 μL; 2.5 mmol / L dNTP, 4 μL; Phusion high-fidelity DNA polymerase (2000U / mL), 1μl; recombinant plasm...

Embodiment 2

[0048] Embodiment 2: the determination of optimal process parameter

[0049] 1. Determination of the optimal working concentration of antigen and antibody

[0050] Dilute the purified p54 recombinant protein with coating solution to a concentration of 0.625 μg / ml, 1.25 μg / ml, 2.5 μg / ml, 5 μg / ml, and 10 μg / ml, add it to the microtiter plate from left to right, 100 μl / well, Incubate overnight at 4°C; the next day, wash 3 times with PBST, 5min each time; block with 200μl / well of 5% skimmed milk at 37°C for 2h. The standard negative and positive serum was serially diluted 1:50, 1:100, 1:200, 1:400, 100 μl / well, added to the microtiter plate from top to bottom, reacted at 37°C for 30 minutes, washed 3 times, 5 minutes each time; Add 1:30,000 enzyme-labeled secondary antibody, incubate at 37°C for 45 minutes, wash 3 times, each time for 5 minutes, and pat dry; add 100 μl TMB chromogenic solution to each well, and protect from light at 37°C for 15 minutes; add 100 μl stop solution t...

Embodiment 3

[0063] Embodiment 3 detects the indirect ELISA kit of African swine fever virus p54 antibody

[0064] Prepare the indirect ELISA kit of detecting African swine fever virus p54 antibody of the present invention through the following steps, and its steps are as follows:

[0065] (1) Coating: Coat the microtiter plate with recombinant ASFV p54 protein, the optimal coating concentration of p54 is 2.5 μg / ml, 100 μl / well, incubate overnight at 4°C, wash 3 times with PBST buffer the next day, each 5 minutes each time, pat dry;

[0066] (2) Blocking: add 5% skimmed milk powder, 100 μl / well, block at 37°C for 1.5h, wash 3 times, 5min each time, pat dry; add ELISA plate stabilizer, 100μl / well, block at 37°C for 1h, wash 3 times, 5 minutes each time. (3) Serum incubation: add 1:200 diluted serum to be tested, incubate at 37°C for 30 minutes, wash 3 times, 5 minutes each time, and pat dry;

[0067] (4) Secondary antibody incubation: add 1:30000 enzyme-labeled secondary antibody, incuba...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an indirect ELISA antibody detection kit for prokaryotic soluble expression protein of African swine fever virus p54. The kit is used for detecting the antibody level of the African swine fever virus p54 in swine serum, and has the advantages of high specificity, good repeatability, high sensitivity and the like. A simple, convenient and reliable method is provided for early diagnosis of African swine fever.

Description

technical field [0001] The invention relates to the field of virus detection, in particular to the field of detection of African swine fever virus antibody. Background technique [0002] African swine fever (ASF) is an acute and severe infectious disease caused by African swine fever virus (ASFV) infecting domestic pigs and wild boars. Pigs of all ages are susceptible. The World Organization for Animal Health (OIE) lists it as a legally notifiable animal disease, and this disease is also a class of animal diseases that my country focuses on preventing. It is characterized by a short course of disease, the most acute and acute infection mortality rate is as high as 100%, clinical manifestations are fever, rapid heartbeat, dyspnea, serous or mucopurulent secretions in the eyes and nose, cyanosis of the skin, heart and lung lobes , bile duct, lymph nodes, kidney, gastrointestinal mucosa bleeding, spleen congestion and enlargement. ASF was first reported in Africa in 1909. S...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/01C12N15/70G01N33/68G01N33/58G01N33/569G01N33/543
CPCC07K14/005C07K2319/21C12N15/70C12N2710/12022C12N2710/12051G01N33/54306G01N33/56983G01N33/581G01N33/6854G01N2333/01G01N2469/20
Inventor 翁长江步志高黄丽张元峰赵东明张涛清刘任强
Owner HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com