Plant salt-resistant protein MsVNI1 as well as coding gene and application thereof

A plant and protein technology, applied in the field of plant genetic engineering, can solve the problems of improving plant yield and quality molecular design, insufficient plant salt-tolerant gene resource bank, etc., to achieve the effect of increasing leaf size and salt-tolerant quality

Pending Publication Date: 2020-08-11
QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In view of the technical needs in the field of plant salt tolerance in the background technology, the purpose of the present invention is to provide a plant salt-resistant protein MsVNI1 and its encoding gene and application, so as to solve the shortage of the current plant salt-tolerant gene resource bank, which cannot meet the needs of improving plant yield and quality at the same time Molecular Design Needs Questions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant salt-resistant protein MsVNI1 as well as coding gene and application thereof
  • Plant salt-resistant protein MsVNI1 as well as coding gene and application thereof
  • Plant salt-resistant protein MsVNI1 as well as coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1: Cloning of MsVNI1 gene

[0032] The primers: MsVNI1-F and MsVNI1-R were designed on both sides of the full-length sequence of MtVNI1, a species of Medicago truncatula with high homology in the genome, and PCR amplification was performed using the cDNA of Medicago sativa as a template.

[0033] The primer sequences are as follows:

[0034] MsVNI1-F: CCCTTCCGTGCTTCATA

[0035] MsVNI1-R: CTCAAATAAATCAGCCATCA

[0036] The PCR reaction system is: 2 μL cDNA, 5 μL 10×Buffer, 4 μL 2.5mMdNTP, 10 μM forward / reverse primers 1 μL each, 0.5 μL 5U / μL Taq enzyme and 36.5 μL ddH 2 O. Mix well after adding the sample on ice. The PCR reaction conditions were: 94°C for 5 min; 94°C for 30 sec, 56°C for 45 sec; 72°C for 2 min, 34 cycles; 72°C for 10 min.

[0037] PCR amplified product was carried out 1% agarose gel electrophoresis detection, obtained the fragment that fragment size is 1544bp ( figure 1 ), carried out gel recovery (using Promega gel recovery kit) to the a...

Embodiment 2

[0038] Example 2: Construction of recombinant vector and transient expression in tobacco cells to observe subcellular localization

[0039] Using the sequence fragment obtained above as a template, MsVNI1 was designed with a linker primer infused with the expression vector pCABIA1300-cGFP, and the fragment was amplified with high-fidelity enzymes; the expression vector pCABIA1300-cGFP was digested with restriction endonuclease BamHI. The MsVNI1 gene fragment and the pCABIA1300-cGFP vector fragment were recovered. The two recovered fragments were then connected by homologous recombination using Infusion enzyme (purchased from Vazyme). The ligation product was transformed into Escherichia coli DH5α competent cells by heat shock method, added 600 μL of liquid LB medium, incubated for 1 h, spread on LB plates of Khanna antibiotics, and incubated at 37°C for 14 h. Single-clonal colonies were picked, amplified and cultured in liquid LB medium containing kanamycin, and subjected to ...

Embodiment 3

[0041] Embodiment 3: Obtaining of overexpressing MsVNI1 transgenic Arabidopsis plants

[0042] The overexpression vector was designed to connect the primers of the entry vector: MsVNI1-OE-F and MsVNI1-OE-R, and the end of the primer was introduced into the BamHI restriction site and the 9 bases after the entry vector pENTRE restriction site (Infusion linker sequence). The obtained full-length sequence of MsVNI1 was used as a template, and PCR amplification was performed with the above-mentioned primers.

[0043] The primer sequences are as follows:

[0044] MsVNI1-OE-F: TCCTTCACCCGGGATCCATGGCCGAAACAAAATTGAT

[0045] MsVNI1-OE-R: ACCCTTTATCGGGATCCCCAGCCATCATGTTTAGTCT

[0046] Among them, the underline is the Infusion linker sequence.

[0047] The above-mentioned amplified fragment is recovered. The pENTRE vector was digested with restriction endonuclease BamHI and recovered. The above two fragments were ligated and transformed into Escherichia coli to obtain a positive clo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a plant salt-resistant protein MsVNI1 as well as a coding gene and application thereof, and belongs to the technical field of plant genetic engineering. The amino acid sequence of the plant salt-resistant protein MsVNI1 is shown as SEQ ID NO.2, and the nucleotide sequence is shown as SEQ ID NO.1. The plant salt-resistant protein MsVNI1 is subjected to molecular regulation,so that the salt-resistant quality of arabidopsis thaliana can be remarkably improved, and the size of alfalfa leaves is increased. The salt-resistant protein MsVNI1 has important reference significance for genetic improvement of biomass and stress resistance of pasture and other crops.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, and specifically relates to plant salt-resistant protein MsVNI1, its coding gene and its application. Background technique [0002] Alfalfa (Medicago sativa L.) is a perennial leguminous forage, which is the most widely planted forage species in my country. Because of its high yield, high nutritional quality, and strong palatability, it is known as the "king of forage grass" and plays an important role in the development of animal husbandry in my country. In addition, the root system of alfalfa is very developed and has strong resistance to abiotic stress. With the large-scale cultivation and intensive production of alfalfa, the demand for new alfalfa varieties with high quality, high resistance and high yield is becoming increasingly urgent. Using genetic engineering to improve the quality of alfalfa can more quickly breed high-quality, high-yield, and high-stress alfalfa var...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N15/66A01H5/00A01H6/20
CPCC07K14/415C12N15/66C12N15/8273
Inventor付春祥杨瑞娟刘文文张晓伟曹英萍白史且周传恩吴振映王亚梅姜珊珊
OwnerQINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI