A kind of rice sheath blight MAPK protein kinase gene target fragment rsmapk and its application
A technology of rice sheath blight bacteria and protein kinase gene, applied in application, genetic engineering, plant gene improvement, etc., can solve the problems of lack of MAPK protein kinase gene function and application research, etc., to solve soil-borne fungal diseases and reduce pathogenicity The effect of disease resistance and wide application prospect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Example 1 Cloning of the target fragment Rsmpk of the MAPK protein kinase gene of Rhizoctonia oryzae
[0044] 1. Experimental method
[0045] Cloning of the MAPK protein kinase gene target fragment Rsmpk of Rhizoctonia oryzae, including the following steps:
[0046] S1. Extraction of RNA from Rhizoctonia solani
[0047] Rice sheath blight RNA was extracted using TaKaRa total RNA extraction kit (code No. 9769). Weigh 0.1 g of Rhizoctonia oryzae mycelium, quickly grind it into powder in liquid nitrogen, add it to a 1.5 mL sterilized centrifuge tube containing Buffer RL lysate, and centrifuge the lysate at 12,000 rpm at 4°C for 5 min. Carefully pipette the supernatant into a new 1.5 mL sterile centrifuge tube. Add 1 / 2 volume of absolute ethanol of the supernatant in the sample lysis step, and immediately transfer all the mixture (containing the precipitate) to the RNASpin Column (containing 2mL Collection Tube). Centrifuge at 12,000 rpm for 1 min and discard the filtra...
Embodiment 2
[0056] Example 2 Expression analysis of MAPK protein kinase gene during rice sheath blight infection process
[0057] 1. Experimental method
[0058] Expression analysis of MAPK protein kinase gene during rice sheath blight infection process, including the following steps:
[0059] S1. Preparation of inoculation spray: First, the GD-118 strain (Shu Canwei et al., a An optimized protein extraction method suitable for two-dimensional electrophoresis of Rhizoctonia solani, Journal of Huazhong Agricultural University, 2017) activation, cultured at 28 °C for 2 d under dark conditions. Then use a sterilized blade to cut the PDA plate with fungi into square mycelium blocks with a side length of about 1 mm, transfer them to a conical flask (containing 200 mL of PDB), under dark conditions, 28 ° C, 180 r / min , After shaking for 2 days, the whole bottle was homogenized into a liquid, so that the OD600 was 1.0, and it could be used for inoculation.
[0060] S2. Rice planting and inocu...
Embodiment 3
[0067] Example 3 Synthesis and in vitro silencing experiments of dsRNA containing target fragment Rsmpk
[0068] 1. Experimental method
[0069] Synthesis and in vitro silencing experiments of dsRNA containing the target fragment Rsmpk, including the following steps:
[0070] S1. In vitro synthesis of dsRNA containing target fragment Rsmapk: T7RNA Polymerase (ThermoFisher Scientific, Catalog number: EP011) was used to synthesize dsRNA containing target fragment Rsmapk. The T7 RNA polymerase promoter can be added to any DNA sequence using PCR by adding the T7 promoter sequence to the 5' end of any amplification primer.
[0071]The minimal T7 RNA polymerase promoter sequence is: 5'-TAATACGACTCACTATAGG-3'. The T7 promoter sequence was added to the 5' ends of the upstream and downstream primers, respectively, and the dsRNA synthesis primers T7-4099F / R, namely the upstream primer T7-4099F: TAATACGACTCACTATAGGACCCTCCAACCTGCTCCTAA, as shown in SEQ ID NO: 13; the downstream primer T...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More