Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application of salmonella gallinarum SifA protein in preparation of ELISA antibody detection kit for detecting salmonella gallinarum antibodies

A technology for antibody detection and Salmonella, which is applied in the field of biotechnology and animal bacteriology detection, can solve the problems of low sensitivity and specificity, and achieve the effects of improving specificity, low detection cost, and easy mass production

Active Publication Date: 2020-08-14
HUAZHONG AGRI UNIV
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although this method is simple to operate, low in cost, does not require professional personnel to operate, and can be operated on-site, it has low sensitivity and specificity, strong subjectivity, and different manufacturers or different batches of the same manufacturer have different test results (Gu Xiaoxue, Liu Yang , Huo Siqi, Liu Yuliang, Han Xue, Zhang Qian, Zhai Xinyan, Wang Chuanbin. Comparison and evaluation of detection reagents for pullorum / fowl typhi Salmonella antibody. Chinese Journal of Veterinary Medicine, 2018, 38:108–112)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of salmonella gallinarum SifA protein in preparation of ELISA antibody detection kit for detecting salmonella gallinarum antibodies
  • Application of salmonella gallinarum SifA protein in preparation of ELISA antibody detection kit for detecting salmonella gallinarum antibodies
  • Application of salmonella gallinarum SifA protein in preparation of ELISA antibody detection kit for detecting salmonella gallinarum antibodies

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Synthesis or cloning of embodiment 1 target gene (sifA)

[0042] (1) Synthesis of Salmonella gallinarum sifA gene

[0043] The Salmonella gallinarum sifA gene can be obtained through synthesis, and the nucleotide sequence is shown in SEQ ID No.1.

[0044] (2) Amplification of Salmonella gallinarum sifA gene

[0045] The primers for amplifying the sifA gene of Salmonella gallinarum were designed using Primer Premier 5 software according to the GenBank gene sequence accession number CP007319.2 of Salmonella gallinarum. The primer nucleic acid was synthesized by Wuhan Qingke Innovation Biotechnology Co., Ltd. The primer sequence is as follows:

[0046] P1, CCG GAATT (EcoR I)CCCGATTACTATAGGGAATGG,

[0047] P2, CCG CTCGAG (Xho I)TTAGCCGCTTTGTTGTTCT.

[0048] Use the genome of Salmonella enteritidis SA083 as a template to carry out PCR amplification. The PCR system is: the total volume is 50 μL. Take the PCR tube and add 22 μL ddH 2 O. 25 μL Primer STAR Max DNA Polymer...

Embodiment 2

[0060] The preparation of embodiment 2 standard positive serum and negative serum

[0061] The 21-day-old healthy SPF chickens were randomly divided into 7 infection groups and 1 control group, with 15 chickens in each group. The infection groups were Salmonella pullorum group, Salmonella enteritidis group, Salmonella typhimurium group, Escherichia coli group, Pasteurella group, Bordetella group, Paragallinia group. Each infection group was randomly divided into 3 infection gradients, with 5 chickens in each gradient. Among them, Salmonella pullorum, Salmonella enteritidis, Salmonella typhimurium, Escherichia coli, and Aviella paragallinarum were infected by oral gavage; Pasteurella, Bordetella nasal drops and eye drops were infected. In the intragastric infection group, they fasted for 12 hours and water for 4 hours before infection, and took 0.5 mL of 5% sodium bicarbonate solution orally 0.5 hours before infection to neutralize gastric acid. The specific infection mode is...

Embodiment 3

[0065] The determination of embodiment 3 Salmonella chicken SifA-ELISA antibody detection kit detection conditions

[0066] (1) Determination of the optimum coating concentration of the antigen

[0067] Determine the antigen coating concentration and the dilution factor of the primary antiserum according to the square array experiment. The recombinant protein was diluted to 8 gradients of 1 μg / mL, 0.5 μg / mL, 0.25 μg / mL, 0.125 μg / mL, 0.062 μg / mL, 0.031 μg / mL, 0.016 μg / mL, 0.008 μg / mL, and the serum was 1:50, 1:100, 1:200, 1:400 times dilution, the enzyme-labeled secondary antibody was diluted 1:10000 times, and the rest of the conditions were in accordance with the conventional ELISA operation steps. Detect OD 630 Value, determine the optimal coating concentration of antigen and the optimal dilution factor of serum. Select the OD of the positive serum 630 The value is around 1.0, and positive serum OD 630 / negative serum OD 630 When the (P / N) value is the largest, it is ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of salmonella gallinarum SifA protein in preparation of an ELISA antibody detection kit for detecting a salmonella gallinarum antibody. According to the invention,the salmonella gallinarum SifA protein is expressed and purified as a coating antigen of ELISA; the working procedure of the kit is optimized; standard positive serum of salmonella pullorum, salmonella enteritidis, salmonella typhimurium, escherichia coli, pasteurella, bordetella and avibacterium paragallinarum is prepared from SPF chickens, standard negative serum is prepared from healthy SPF chickens, the kit is used for detecting the prepared positive serum and negative serum to prove that the kit has good specificity. The kit provided by the invention detects a large amount of clinical serum, and is compared with a glass plate agglutination test commonly used for clinically detecting salmonella to prove the practicability of the kit. The kit can be used for detecting antibodies after salmonella gallinarum infection, and a rapid and accurate antibody detection method is provided for salmonella gallinarum diseases.

Description

technical field [0001] The invention relates to the technical fields of biotechnology and animal bacteriology detection, in particular to the application of a Salmonella gallinarum SifA protein in the preparation of an ELISA antibody detection kit for detecting Salmonella chicken antibodies. Background technique [0002] Salmonella is one of the zoonotic pathogens legally reported by the World Health Organization, and it is listed as a second-class infectious disease in my country, which poses a major threat to animal husbandry production and human health (Luo Wei, Huang Cuiying, Wang Fan, Liu Bowen, Pan Zhiming, Geng Shizhong, Jiao Xin'an. Investigation, drug resistance analysis and molecular typing of Salmonella in a large-scale breeding chicken farm [C]. Chinese Society of Animal Husbandry and Veterinary Medicine. The 2018 Academic Annual Meeting of the Chinese Society of Animal Husbandry and Veterinary Medicine, Poultry Disease Branch No. Proceedings of the Nineteenth Acad...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/68G01N33/569G01N33/543C12N15/70C12N15/31C12R1/42
CPCC07K14/255C12N15/70G01N33/54393G01N33/56916G01N33/6854G01N2333/255G01N2469/20
Inventor 蔡旭旺高东阳于江旭田艳红焦宇洲王迪轩徐晓娟
Owner HUAZHONG AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More