Application of salmonella gallinarum SifA protein in preparation of ELISA antibody detection kit for detecting salmonella gallinarum antibodies
A technology for antibody detection and Salmonella, which is applied in the field of biotechnology and animal bacteriology detection, can solve the problems of low sensitivity and specificity, and achieve the effects of improving specificity, low detection cost, and easy mass production
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Synthesis or cloning of embodiment 1 target gene (sifA)
[0042] (1) Synthesis of Salmonella gallinarum sifA gene
[0043] The Salmonella gallinarum sifA gene can be obtained through synthesis, and the nucleotide sequence is shown in SEQ ID No.1.
[0044] (2) Amplification of Salmonella gallinarum sifA gene
[0045] The primers for amplifying the sifA gene of Salmonella gallinarum were designed using Primer Premier 5 software according to the GenBank gene sequence accession number CP007319.2 of Salmonella gallinarum. The primer nucleic acid was synthesized by Wuhan Qingke Innovation Biotechnology Co., Ltd. The primer sequence is as follows:
[0046] P1, CCG GAATT (EcoR I)CCCGATTACTATAGGGAATGG,
[0047] P2, CCG CTCGAG (Xho I)TTAGCCGCTTTGTTGTTCT.
[0048] Use the genome of Salmonella enteritidis SA083 as a template to carry out PCR amplification. The PCR system is: the total volume is 50 μL. Take the PCR tube and add 22 μL ddH 2 O. 25 μL Primer STAR Max DNA Polymer...
Embodiment 2
[0060] The preparation of embodiment 2 standard positive serum and negative serum
[0061] The 21-day-old healthy SPF chickens were randomly divided into 7 infection groups and 1 control group, with 15 chickens in each group. The infection groups were Salmonella pullorum group, Salmonella enteritidis group, Salmonella typhimurium group, Escherichia coli group, Pasteurella group, Bordetella group, Paragallinia group. Each infection group was randomly divided into 3 infection gradients, with 5 chickens in each gradient. Among them, Salmonella pullorum, Salmonella enteritidis, Salmonella typhimurium, Escherichia coli, and Aviella paragallinarum were infected by oral gavage; Pasteurella, Bordetella nasal drops and eye drops were infected. In the intragastric infection group, they fasted for 12 hours and water for 4 hours before infection, and took 0.5 mL of 5% sodium bicarbonate solution orally 0.5 hours before infection to neutralize gastric acid. The specific infection mode is...
Embodiment 3
[0065] The determination of embodiment 3 Salmonella chicken SifA-ELISA antibody detection kit detection conditions
[0066] (1) Determination of the optimum coating concentration of the antigen
[0067] Determine the antigen coating concentration and the dilution factor of the primary antiserum according to the square array experiment. The recombinant protein was diluted to 8 gradients of 1 μg / mL, 0.5 μg / mL, 0.25 μg / mL, 0.125 μg / mL, 0.062 μg / mL, 0.031 μg / mL, 0.016 μg / mL, 0.008 μg / mL, and the serum was 1:50, 1:100, 1:200, 1:400 times dilution, the enzyme-labeled secondary antibody was diluted 1:10000 times, and the rest of the conditions were in accordance with the conventional ELISA operation steps. Detect OD 630 Value, determine the optimal coating concentration of antigen and the optimal dilution factor of serum. Select the OD of the positive serum 630 The value is around 1.0, and positive serum OD 630 / negative serum OD 630 When the (P / N) value is the largest, it is ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



