Probe set and reagent kit for detecting microsatellite instability through high-flux sequencing, and detection method of microsatellite instability

A microsatellite instability and detection method technology, applied in the field of detection of microsatellite instability, can solve the problems of genome instability and increased susceptibility to tumors of patients, and achieve the requirements of controlling sequencing costs, high effective depth, and reducing sample size Effect

Active Publication Date: 2020-09-22
杭州祥音医学检验实验室有限公司 +1
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Mismatch repair-deficient cells cause genomic instability associated with microsatellite instability (MSI), with increased tumor susceptibility in patients

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Probe set and reagent kit for detecting microsatellite instability through high-flux sequencing, and detection method of microsatellite instability
  • Probe set and reagent kit for detecting microsatellite instability through high-flux sequencing, and detection method of microsatellite instability
  • Probe set and reagent kit for detecting microsatellite instability through high-flux sequencing, and detection method of microsatellite instability

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] The preparation of embodiment 1 capture probe

[0050] Probe sequences were synthesized using methods known in the art, uniformly mixed in TE with a total volume of 1 ml, and 1 μl of them were used for PCR amplification using the general PCR primers shown in the following table. PCR amplification system: the above-mentioned probe solution, 1 μl; Forward primer (20 μM), 1 μl; reverse primer (20 μM), 1ul; 47 μL Platinum PCR Supermix, total volume 50 μL. Amplification conditions: 95°C, 2min; (94°C, 30s, 55°C, 30s, 72°C, 30s) 20 cycles; 72°C, 5min.

[0051] Sequence (5'-3') TAATACGACTCACTATAGGGATCGCACCAGCGTGT AGAAGAGTCACATAC

[0052] The PCR product was purified with MinElute PCR Purification Kit and stored at -20°C. Take 500ng, and use Ambion SP6 megascript kit to perform in vitro transcription on the product after PCR purification. The in vitro transcribed RNA was purified using Qiagen RNeasy minikit, and the purified product was the biotin-labe...

Embodiment 2

[0053] Example 2 Specific capture and sequencing

[0054] In this example, the capture probe set provided in Example 1 was used, and the target sequence was enriched by the sequence capture technology based on liquid phase hybridization. The technical route of liquid phase hybridization is: 1) preparing a hybridization probe library, 2) using the probes to enrich the target gene, and 3) sequencing the enriched DNA sequence with a high-throughput sequencer.

[0055] The library construction method comprises the following steps:

[0056] 1. DNA extraction and fragmentation

[0057] DNA was extracted from 4 peripheral blood samples using the QIAamp DNA Blood Mini Kit.

[0058] Use the Bioruptor Pico DNA interrupter, after the temperature of the cold cycler drops to 4°C, set the parameters ON for 30s, OFF for 30s as a cycle, every 10 cycles as a round, a total of 3 rounds, after each group, the samples were placed in Mix well on a shaker, centrifuge briefly and interrupt for th...

Embodiment 3

[0100] 20 colorectal cancer samples with known MSI types and plasma samples from corresponding patients were collected, and tested according to the procedure shown in Example 2. The test results are shown below.

[0101]

[0102] Can draw from above-mentioned result, use probe of the present invention to detect microsatellite state of different samples, the accuracy of tissue sample reaches 100%, specificity reaches 100%, the accuracy of plasma sample reaches 97.5%, specificity reaches 100% %.

[0103] According to the above description, the present invention has the following advantages: 1. High accuracy, strong sensitivity, high throughput, and can effectively and accurately detect microsatellite instability in tumor patients. 2. The microsatellite instability detection method based on next-generation sequencing data can eliminate the need for a separate and specialized detection of MSI status, and can detect microsatellite instability in clinical practice while detecting...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a probe set and reagent kit for detecting microsatellite instability through high-flux sequencing, and a detection method of microsatellite instability, and relates to the technical field of genetic detection. The probe set provided by the invention can catch 11 microsatellite instability evaluation sites of BAT26, BAT25, BAT-34c4, BAT-40, D2S123, D5S346, MONO-27, NR21, NR24, NR27 and D17S250 through high-flux sequencing, the microsatellite instability state of an object to be detected can be accurately assessed, and a theoretical basis and guide are provided for formulation of a prognosis and clinical treatment scheme for patients suffering from tumors.

Description

technical field [0001] The invention relates to the technical field of gene detection, in particular to a probe set, a kit and a detection method for microsatellite instability using high-throughput sequencing to detect microsatellite instability. Background technique [0002] Microsatellites refer to short tandem repeats that are ubiquitous in the human genome. The general repeating unit is 1 to 5 bases, and the repeating number of the repeating unit varies from 10 to dozens of times. Most microsatellite sequences are located in non-coding regions of the genome. [0003] The DNA repair system is closely related to the occurrence of tumors. Studies have shown that it takes multiple somatic mutations to lead to the transformation of cells from normal cells to tumor cells. In more than 50% of tumors, mutations in DNA repair and replication genes can be detected. When the DNA mismatch repair system is functioning normally, if the microsatellite repeat sequence is replicated ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6886C12Q1/6869C12N15/11
CPCC12Q1/6886C12Q1/6869C12Q2600/156C12Q2600/118C12Q2535/122C12Q2525/151C12Q2531/113C12Q2565/519Y02A50/30
Inventor张光谋
Owner杭州祥音医学检验实验室有限公司