Organic-solvent-resistant protease mutant of bacillus sphaericus
A technology resistant to organic solvents and proteases, applied in the field of bioengineering, can solve problems such as poor stability, increase organic solvent tolerance, reduce costs, etc., and achieve the effects of increased organic solvent tolerance, high economic value and social value.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0044] Implementation Example 1: Construction of mutant expression plasmid and acquisition of recombinant Pichia Pastoris X33
[0045] Use the online optimization tool JCAT to optimize the protease gene sph according to the codon preference of Pichia Pastoris X33. The codon optimization has no effect on the sequence, and the His tag is added to the N-terminal, and the restriction endonucleases of Xba I and Ecor I Restriction sites were added to the C-terminus and N-terminus respectively, the gene was synthesized, and directly connected to the plasmid PUC57, and the primers were designed and verified according to the target gene and plasmid, specifically:
[0046] ppicZalphA-F1: ATGGACTCTGAGGACTCTTTGGGT
[0047] ppicZalphA-R1:AGAAGCGTAGTCGTCACCAATAGC
[0048] The target gene and plasmid were amplified by PCR, and the plasmid PUC57-sph containing the target gene sph and the expression plasmid ppicZalphA were double-enzyme-digested with restriction endonucleases Xba I and ECOR I...
Embodiment 2
[0063] Implementation Example 2: Induced Expression of Recombinant Bacteria
[0064] Inoculate the monoclonal transformants in 2mL YPD, culture in a shaker at 30°C and 200 rpm until OD600 to 2-8, inoculate 1% in the medium of a 250ml Erlenmeyer flask containing 10mL BMGY, and incubate at 30°C , 200 rpm, cultured until OD600 was 2-6, centrifuged to collect the bacteria with a sterile centrifuge tube, discarded the BMGY medium, suspended in a 250ml Erlenmeyer flask with 20mL BMMY, induced expression at 30°C, added every 24h at a final concentration of 0.5% or 1% methanol, and sampled, induced for 5 days, centrifuged to get the supernatant, the supernatant is the mutant protease crude enzyme solution.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap