Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Organic-solvent-resistant protease mutant of bacillus sphaericus

A technology resistant to organic solvents and proteases, applied in the field of bioengineering, can solve problems such as poor stability, increase organic solvent tolerance, reduce costs, etc., and achieve the effects of increased organic solvent tolerance, high economic value and social value.

Pending Publication Date: 2020-11-24
JIANGSU OCEAN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, most natural proteases are extremely poor in stability in organic solvents and are prone to lose activity, which greatly limits the application of proteases in the field of organic synthesis.
At present, a large number of studies have shown that the tolerance of enzymes to organic solvents can be improved through solvent engineering and biocatalytic engineering, but these methods are not only costly, but also easily lead to a decrease in enzyme activity. Therefore, obtaining natural organic solvent-stabilized proteases or utilizing protein Engineering proteases to increase their tolerance to organic solvents can significantly reduce costs, so the present invention provides a new method for improving the tolerance of enzymes to organic solvents based on the rapid development of enzyme engineering, especially directed evolution technology: by using Techniques such as site-directed mutagenesis, site-directed saturation mutagenesis, and DNA-shuffling can improve the organic solvent tolerance of enzymes, so that they can better meet the needs of industrial catalysis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Implementation Example 1: Construction of mutant expression plasmid and acquisition of recombinant Pichia Pastoris X33

[0045] Use the online optimization tool JCAT to optimize the protease gene sph according to the codon preference of Pichia Pastoris X33. The codon optimization has no effect on the sequence, and the His tag is added to the N-terminal, and the restriction endonucleases of Xba I and Ecor I Restriction sites were added to the C-terminus and N-terminus respectively, the gene was synthesized, and directly connected to the plasmid PUC57, and the primers were designed and verified according to the target gene and plasmid, specifically:

[0046] ppicZalphA-F1: ATGGACTCTGAGGACTCTTTGGGT

[0047] ppicZalphA-R1:AGAAGCGTAGTCGTCACCAATAGC

[0048] The target gene and plasmid were amplified by PCR, and the plasmid PUC57-sph containing the target gene sph and the expression plasmid ppicZalphA were double-enzyme-digested with restriction endonucleases Xba I and ECOR I...

Embodiment 2

[0063] Implementation Example 2: Induced Expression of Recombinant Bacteria

[0064] Inoculate the monoclonal transformants in 2mL YPD, culture in a shaker at 30°C and 200 rpm until OD600 to 2-8, inoculate 1% in the medium of a 250ml Erlenmeyer flask containing 10mL BMGY, and incubate at 30°C , 200 rpm, cultured until OD600 was 2-6, centrifuged to collect the bacteria with a sterile centrifuge tube, discarded the BMGY medium, suspended in a 250ml Erlenmeyer flask with 20mL BMMY, induced expression at 30°C, added every 24h at a final concentration of 0.5% or 1% methanol, and sampled, induced for 5 days, centrifuged to get the supernatant, the supernatant is the mutant protease crude enzyme solution.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an organic-solvent-resistant protease mutant of bacillus sphaericus. The mutant is characterized in that a bacillus sphaericus protease gene is subjected to the following mutations: threonine (T) at site 39 is mutated into proline (P); glutamine (Q) at site 87 is mutated into proline (P); serine (S) at site 108 is mutated into glycine (G); tyrosine (Y) at site 172 is mutated into glutamic acid (E); and asparagine (N) at site 198 is mutated into tryptophan (W). The codon optimization sequence of an organic-solvent-resistant protease mutant gene of Bacillus sphaericus isas shown in an appendix 1, and the GenBank accession number of a Bacillus sphaericus amino acid sequence is AJ238598.1. According to the organic-solvent-resistant protease mutant of bacillus sphaericus disclosed in the invention, compared with protease without mutation, the organic solvent tolerance of the mutant protease is 3.15 times the organic solvent tolerance of a wild enzyme; and the mutantprotease has better organic solvent tolerance and better meets the requirements of industrial production.

Description

technical field [0001] The invention belongs to the technical field of biological engineering and discloses a Bacillus sphaericus Organosolvent-resistant protease mutants. Background technique [0002] Protease is a class of hydrolytic enzymes that can catalyze the hydrolysis of peptide bonds in proteins and polypeptides. It belongs to the fourth subclass (EC 3.4) of the third class of hydrolytic enzymes. Oneness, high selectivity and many other advantages are widely used in many fields such as protein, detergent, food, pharmaceuticals, leather, etc., but due to harsh conditions in industrial applications such as: high temperature, strong acid, strong alkali and chemical organic Solvents, etc., proteases are prone to lose activity, and the low stability under these extreme conditions greatly limits the application of proteases in various fields. [0003] In recent years, the rapid development of non-aqueous enzymology has further expanded the application of protease in the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/54C12N15/81C12R1/84
CPCC12N9/54C12N15/815C12N2800/22
Inventor 刘姝房耀维卢静杨杰杨光焦豫良吴新财张唯张弘彧
Owner JIANGSU OCEAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com