Xylanase mutant with improved specific activity

A xylanase mutation and mutant technology, which is applied in the fields of genetic engineering and protein modification, can solve the problems of increased incidence of livestock and poultry, difficult sanitation control, and reduced feed intake, and achieves significant effects, promotes wide application, reduces The effect of production costs

Active Publication Date: 2020-12-18
QINGDAO VLAND BIOTECH GRP
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In actual production, xylan in feed raw materials cannot be effectively degraded, which will significantly reduce the digestibility of nutrients, reduce feed intake, and affect the production performance of livestock and poultry
The excretion of viscous feces brings difficulties to sanitation control and increases the incidence of livestock and poultry; at the same time, it can also affect the deposition of poultry egg pigment, making the carcass of meat and poultry turn white and reduce the carcass grade

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0102] Example 1 Screening of high specific activity xylanase mutants

[0103] The amino acid sequence of the wild-type xylanase PT derived from the eukaryotic chytrid phylum Neomenopsis genus is SEQ ID NO: 1, and its coding nucleotide sequence is SEQ ID NO: 2. In order to improve the specific activity of xylanase PT, the applicant conducted protein structure analysis on its gene. The protein is a right-hand half-grip made of folded sheets, with two catalytic residues located in clefts formed by highly twisted β-sheets that accommodate xylan sugar chains. On the premise of not destroying the protein secondary structure and active center, the applicant further mutated the gene.

[0104] 1.1 Design PCR primers PT-F1, PT-R1:

[0105] PT-F1: GGC GAATTC CAAAGTTTCTGTAGTTCAGCTTCTC (the underline is the restriction endonuclease EcoRI recognition site);

[0106] PT-R1: ATA GCGGCCGC TTATCATTAATCACCAATGTAAACCT (the underline is the recognition site of the restriction enzyme NotI...

Embodiment 2

[0111] Example 2 Expression of xylanase mutants in Pichia pastoris

[0112] According to the coding preference of Pichia pastoris, the gene sequence of PT, SEQ ID NO: 2, and the gene sequence of the above-mentioned mutant were optimized and synthesized, and EcoRI and NotI were added to the 5' and 3' ends of the synthetic sequence respectively. Restriction sites.

[0113]2.1 Construction of expression vector

[0114] The gene sequences of the synthetic PT and its mutants were digested with EcoRI and NotI respectively, and then ligated with the pPIC-9K vector after the same digestion at 16°C overnight, and transformed into E. coli DH5a, and spread on the LB+Amp plate , cultured upside down at 37°C, and after transformants appeared, colony PCR (reaction system: template-picked single clone, rTaqDNA polymerase 0.5 μL, 10×Buffer 2.0 μL, dNTPs (2.5 mM) 2.0 μL, 5'AOX primer ( 10M): 0.5 μl, 3’AOX primer: 0.5 μl, ddH 2 O14.5μL, reaction program: 95°C pre-denaturation for 5min, 30 cy...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention aims to provide a xylanase mutant with improved specific activity and application of the xylanase mutant. The mutant comprises any one or more mutation sites in M78F, V143I, R148K, F163W, I177V and V206L. Compared with a wild type, the xylanase mutant has the advantages that the specific activity of the mutant is remarkably improved, so that the production cost of xylanase is reduced, and wide application of the xylanase in feed is promoted.

Description

technical field [0001] The invention relates to the technical field of genetic engineering and protein transformation, in particular to a xylanase mutant with improved specific activity. Background technique [0002] Xylan (xylan) is a hybrid five-carbon sugar, the main chain is connected by multiple xylopyranosyl groups through xylosidic bonds, and a variety of short substituents of different sizes are attached to the side chains. Xylan mainly exists in the secondary wall of plant cells and acts as a link between lignin and other polysaccharides. Xylan is an important component of plant hemicellulose, which accounts for one-third of the total plant carbohydrates, and is the second most abundant renewable material resource after cellulose in nature. Xylan accounts for 7%-12% of dry matter weight in gymnosperms and 15%-30% of dry matter weight in angiosperms. The main raw materials of livestock and poultry feed in my country come from plants, such as corn, wheat, barley, et...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/42C12N15/56C12N15/81C12N1/19A23K20/189C12R1/84
CPCC12N9/2482C12N15/815A23K20/189C12Y302/01008A23K10/14A23K50/75C12R2001/645Y02P60/87C12N15/52C12N2330/51
Inventor 吴秀秀宋嵘锡黄亦钧
Owner QINGDAO VLAND BIOTECH GRP
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap