Xylanase mutant with improved specific activity
A xylanase mutation and mutant technology, which is applied in the fields of genetic engineering and protein modification, can solve the problems of increased incidence of livestock and poultry, difficult sanitation control, and reduced feed intake, and achieves significant effects, promotes wide application, reduces The effect of production costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0102] Example 1 Screening of high specific activity xylanase mutants
[0103] The amino acid sequence of the wild-type xylanase PT derived from the eukaryotic chytrid phylum Neomenopsis genus is SEQ ID NO: 1, and its coding nucleotide sequence is SEQ ID NO: 2. In order to improve the specific activity of xylanase PT, the applicant conducted protein structure analysis on its gene. The protein is a right-hand half-grip made of folded sheets, with two catalytic residues located in clefts formed by highly twisted β-sheets that accommodate xylan sugar chains. On the premise of not destroying the protein secondary structure and active center, the applicant further mutated the gene.
[0104] 1.1 Design PCR primers PT-F1, PT-R1:
[0105] PT-F1: GGC GAATTC CAAAGTTTCTGTAGTTCAGCTTCTC (the underline is the restriction endonuclease EcoRI recognition site);
[0106] PT-R1: ATA GCGGCCGC TTATCATTAATCACCAATGTAAACCT (the underline is the recognition site of the restriction enzyme NotI...
Embodiment 2
[0111] Example 2 Expression of xylanase mutants in Pichia pastoris
[0112] According to the coding preference of Pichia pastoris, the gene sequence of PT, SEQ ID NO: 2, and the gene sequence of the above-mentioned mutant were optimized and synthesized, and EcoRI and NotI were added to the 5' and 3' ends of the synthetic sequence respectively. Restriction sites.
[0113]2.1 Construction of expression vector
[0114] The gene sequences of the synthetic PT and its mutants were digested with EcoRI and NotI respectively, and then ligated with the pPIC-9K vector after the same digestion at 16°C overnight, and transformed into E. coli DH5a, and spread on the LB+Amp plate , cultured upside down at 37°C, and after transformants appeared, colony PCR (reaction system: template-picked single clone, rTaqDNA polymerase 0.5 μL, 10×Buffer 2.0 μL, dNTPs (2.5 mM) 2.0 μL, 5'AOX primer ( 10M): 0.5 μl, 3’AOX primer: 0.5 μl, ddH 2 O14.5μL, reaction program: 95°C pre-denaturation for 5min, 30 cy...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap