Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of tnk-tpa fusion protein with enhanced transport ability through epithelial cells and its application

A technology of fusion protein and epithelial cells, which is applied in the field of genetically engineered recombinant proteins, can solve problems such as difficult to meet needs, and achieve the effects of reduced molecular weight, great flexibility, and weak binding force

Active Publication Date: 2021-07-20
JIANGSU FENGHUA BIOPHARMACEUTICAL CO LTD
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] Clinically, tenecteplase has many application potentials, but the dosage form of tenecteplase currently used is powder injection, and the route of use is intravenous infusion. This single dosage form and route of use are difficult to meet its clinical application. Indication Application Requirements

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of tnk-tpa fusion protein with enhanced transport ability through epithelial cells and its application
  • A kind of tnk-tpa fusion protein with enhanced transport ability through epithelial cells and its application
  • A kind of tnk-tpa fusion protein with enhanced transport ability through epithelial cells and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1: Construction and cloning of IgG2 Fc mutant gene

[0038] The human antibody IgG2 Fc fragment encoding gene used in the present invention is obtained by conventional gene cloning techniques, that is, the RNA of normal human peripheral blood leukocytes is extracted, transcribed into cDNA molecules, and then PCR-amplified with specific primers to obtain specific fragments. This fragment was cloned into the pUC18 plasmid to obtain the recombinant plasmid pUCIgG2, and its DNA sequence was confirmed by gene sequencing. It was confirmed by DNA sequencing that the cloned human antibody IgG2 Fc fragment coding gene had 100% homology with the human IgG2 antibody cDNA sequence numbered AK130614.1 in GenBank (GenBank) (such as SEQ ID NO: 1, SEQ ID NO: 2 shown).

[0039] In order to obtain the IgG2 Fc mutant gene, site-directed mutagenesis was performed by partial overlapping gene amplification technique. There are four oligonucleotide primers used in PCR amplification,...

Embodiment 2

[0045] Example 2: Construction of TNK-tPA and IgG2 Fcm fusion coding gene and recombinant expression vector

[0046] In order to construct the fusion coding gene of TNK-tPA and IgG2 Fcm, gene recombination was carried out by overlapping gene amplification technology. 所使用的寡核酸引物共有4条,分别为F3(5’gactctagaccaccatggatgcaatgaagaga3’),R3(5’tgagctgtctcggcggcggaggcctcggtggtggtgggccagcgtacaacagtgctta3’)F4(5’cgaccgggtggtggtggctccggaggcggcggctctgtcgagtgcccaccgtgccca3’),R4(5’taagtcgactcatttacccggagacag3’)。 The F3 primer contains the endonuclease XbaI recognition site (tctaga), the kozak sequence (ccaccatgg) and the start codon (atg), and the R4 primer contains the endonuclease SalI recognition site (gtcgac) and the stop codon. The complementary sequences of the primers R3 and F4 contain a flexible linker coding sequence (ggtggtggtggctccggaggcggcggctct) (shown in SEQ ID NO: 5, SEQ ID NO: 6).

[0047] The operation process is as follows:

[0048] The pCD4mtPA recombinant plasmid contains the co...

Embodiment 3

[0054] Example 3: Expression of pCDTPAFcm and pCD4TPAFc recombinant expression plasmids in CHO cells

[0055] The mammalian cell expression system selected in the present invention is Chinese hamster ovary cells (CHO) deficient in dihydrofolate reductase (dhfr). The recombinant expression vector pCD4 contains an expressible dhfr coding gene. After the plasmid is transfected into CHO (dhfr-) cells, the copy number is greatly increased under the pressure of methotrexate (MTX), and at the same time, it drives the high-efficiency expression of the cloned foreign gene.

[0056] After the recombinant expression plasmids pCDTPAFcm and pCD4TPAFc constructed in Example 2 were purified and endotoxin removed, they were transfected into CHO (dhfr-) cells by liposome method, cultured in selective medium and detected by ELISA, and positive expression of TPA was screened of cell lines. For these positive cell lines, the concentration of MTX in the medium was gradually increased, and the hig...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
purityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a TNK-tPA fusion protein with enhanced transport ability through epithelial cells, that is, TPAFcm fusion protein, which is formed by genetic engineering recombination of TNK-tPA and human antibody IgG2 Fc fragment mutant; and TNK without mutation Compared with the ‑tPAFc fusion protein, the mutated TPAFcm removes the glycosyl modification of the Fc fragment, which improves its transport ability through epithelial cells by more than 3 times. In addition to the general advantages of antibody Fc fusion proteins, it also has high epithelial cell absorption efficiency It can be used for the treatment of pulmonary embolism and the prevention and treatment of other vascular embolism diseases; it also provides a theoretical basis and research basis for the development of new formulations of tenecteplase and the expansion of the application range and fields of tenecteplase.

Description

technical field [0001] The present invention relates to the technical field of genetic engineering recombinant protein, in particular to a TNK-tPA fusion protein with enhanced transport ability through epithelial cells, specifically TPAFcm fusion protein; on the other hand, it relates to the preparation method of the TPAFcm fusion protein and its application in medical The application on the Internet, especially the application in the treatment and / or prevention of human vascular embolism diseases. Background technique [0002] Studies have found that neonatal Fc receptors (neonatal constant fragment receptor, FcRn) are still expressed and distributed on some absorptive epithelial cells of adults (such as lung, kidney and small intestinal epithelial cells) (Israel EJ et al.Expression of the neonatal Fcreceptor, FcRn, on human intestinal epithelial cells. Immunology.1997Sep; 92(1):69–74; Haymann JP etal.Characterization and localization of the neonatal Fc receptor in adulthum...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/72C12N15/55C12N15/85C12N5/10A61K38/49A61P7/02
CPCA61K38/00A61P7/02C07K2319/30C12N9/6459C12N15/85C12Y304/21068
Inventor 张慧君杜勇陈太标
Owner JIANGSU FENGHUA BIOPHARMACEUTICAL CO LTD