Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A Strain of Bacillus w608 and Its Application in Controlling Rapeseed Sclerotinia

A technology of Sclerotinia sclerotiorum and Bacillus sclerotiorum, applied in the direction of application, bacteria, fungicides, etc., can solve the problems of increased pathogenic drug resistance, environmental pollution, chemical pesticide residues, etc., and achieves broad antifungal spectrum and simple preparation process , Good biocontrol effect

Active Publication Date: 2022-02-18
FUJIAN AGRI & FORESTRY UNIV +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] For a long time, chemical pesticides have been the main way of plant disease prevention and control. It has played a very important role in the prevention and control of plant diseases and insect pests in agricultural production. However, the long-term unreasonable use of chemical pesticides has caused many problems such as drug residues, environmental pollution, and increased drug resistance of pathogens.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Strain of Bacillus w608 and Its Application in Controlling Rapeseed Sclerotinia
  • A Strain of Bacillus w608 and Its Application in Controlling Rapeseed Sclerotinia
  • A Strain of Bacillus w608 and Its Application in Controlling Rapeseed Sclerotinia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1 Bacillus ( Bacillus sp. ) separation and screening of W608

[0020] The present invention relates to Bacillus ( Bacillus sp. ) W608 is derived from the deep-sea sediment samples collected by the applicant from China's 31st oceanographic scientific expedition. The sediment samples were first diluted with sterile seawater to 10 -10 , respectively take 100 μL of 10 -1 -10 -10 The diluted solution was evenly spread on the LB plate, and each gradient was repeated three times in parallel, and placed in a 28 °C incubator for 48 h. According to the shape, color and other characteristics of the colony, pick a single colony and streak it on the LB culture plate. After 3 rounds of repeated streaking, until each strain is pure cultured, the isolation and purification of the strain is completed.

[0021] The obtained strains were grown on LB medium, and after culturing at 28°C for 24 hours, the cells were opaque and white, and the edges were not smooth and serrated. ...

Embodiment 2

[0023] Bacillus ( Bacillus sp. ) Identification of strains of W608 The 16S rDNA sequence of deep-sea sediment source strain W608 was amplified by using 16S rDNA universal primers 27F and 1492R (27F: AGAGTTTGATCCTGGCTCAT; 1492R: ACGGCTACCTTGTTACGACTT). Using the total DNA of W608 as the PCR amplification template, the PCR reaction was carried out on the PCR amplification instrument. The reaction conditions were: denaturation at 94°C for 1 min; annealing at 55°C for 1 min; extension at 72°C for 1.5 min, 30 cycles. After the amplified sequence was sequenced by a sequencing company, the 16S rDNA sequence of the strain was obtained. The sequence was compared with the nucleic acid data in GenBank of the National Center for Biotechnology Information (http: / / ncbi.nlm.nih.gov / blast). The results showed that the 16S rDNA sequence of W608 was similar to the Bacillus velezensis (MN938176.1), Bacillus siamensis (MN865945.1), and Bacillus amyloliquefaciens (MK182997.1) and other str...

Embodiment 3

[0026] Example 3: Determination of antibacterial spectrum of phytopathogenic fungi

[0027] Bacillus ( Bacillus sp. ) The preparation method of W608 fermentation supernatant is as follows: First, Bacillus ( Bacillus sp. ) W608 was activated and cultured in a test tube containing 5 mL of LB medium, and then the activated strain was inoculated into 500 mL of LB medium for fermentation culture.

[0028] The centrifugation to remove bacterial cells was performed by centrifugation at 10,000 r / min for 20 min.

[0029] The time of the activation culture was 20h.

[0030] The temperature of the fermentation culture is 28°C, the time of the fermentation culture is 48h, and the rotation speed of the shaker for the fermentation culture is 200r / min.

[0031] Determination of Bacillus by the disc method ( Bacillus sp. ) Inhibitory activity of W608 against 8 phytopathogenic fungi. The tested pathogenic fungi were made into colonies with a sterile hole punch, and a colony was picked wit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a strain of bacillus ( Bacillus sp. ) W608 and its application in the prevention and treatment of Sclerotinia sclerotiorum, the strain has been deposited in the China Center for Type Culture Collection on July 21, 2020, and the preservation number is CCTCC NO: M 2020335. The preparation process of the fermentation supernatant of the bacterial strain in the invention is simple, the antifungal spectrum is wide, and the biocontrol effect is good. In the field control test of Sclerotinia sclerotiorum (Sclerotinia sclerotiorum), it has shown good biological control effect, and the control effect can reach more than 57%.

Description

technical field [0001] The present invention relates to Bacillus, especially to a kind of Bacillus ( Bacillus sp. ) W608 and its application in the preparation of fermentation supernatant for the prevention and treatment of Sclerotinia sclerotiorum. Background technique [0002] For a long time, chemical pesticides have been the main method of plant disease prevention and control. They play a very important role in preventing and controlling diseases and insect pests in agricultural production. However, the long-term irrational use of chemical pesticides has caused many problems such as drug residues, environmental pollution and increased pathogen resistance. . Therefore, it is particularly important to develop new plant disease control strategies that are friendly to humans and the environment and have excellent control effects. Biological control is the use of microorganisms or their active products to control crop diseases and insect pests. It has the advantages of high...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/20A01N63/22A01P3/00C12R1/07
CPCA01N63/22C12R2001/07C12N1/205
Inventor 陈新华何天良温巧
Owner FUJIAN AGRI & FORESTRY UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More