A Strain of Bacillus w608 and Its Application in Controlling Rapeseed Sclerotinia
A technology of Sclerotinia sclerotiorum and Bacillus sclerotiorum, applied in the direction of application, bacteria, fungicides, etc., can solve the problems of increased pathogenic drug resistance, environmental pollution, chemical pesticide residues, etc., and achieves broad antifungal spectrum and simple preparation process , Good biocontrol effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Example 1 Bacillus ( Bacillus sp. ) separation and screening of W608
[0020] The present invention relates to Bacillus ( Bacillus sp. ) W608 is derived from the deep-sea sediment samples collected by the applicant from China's 31st oceanographic scientific expedition. The sediment samples were first diluted with sterile seawater to 10 -10 , respectively take 100 μL of 10 -1 -10 -10 The diluted solution was evenly spread on the LB plate, and each gradient was repeated three times in parallel, and placed in a 28 °C incubator for 48 h. According to the shape, color and other characteristics of the colony, pick a single colony and streak it on the LB culture plate. After 3 rounds of repeated streaking, until each strain is pure cultured, the isolation and purification of the strain is completed.
[0021] The obtained strains were grown on LB medium, and after culturing at 28°C for 24 hours, the cells were opaque and white, and the edges were not smooth and serrated. ...
Embodiment 2
[0023] Bacillus ( Bacillus sp. ) Identification of strains of W608 The 16S rDNA sequence of deep-sea sediment source strain W608 was amplified by using 16S rDNA universal primers 27F and 1492R (27F: AGAGTTTGATCCTGGCTCAT; 1492R: ACGGCTACCTTGTTACGACTT). Using the total DNA of W608 as the PCR amplification template, the PCR reaction was carried out on the PCR amplification instrument. The reaction conditions were: denaturation at 94°C for 1 min; annealing at 55°C for 1 min; extension at 72°C for 1.5 min, 30 cycles. After the amplified sequence was sequenced by a sequencing company, the 16S rDNA sequence of the strain was obtained. The sequence was compared with the nucleic acid data in GenBank of the National Center for Biotechnology Information (http: / / ncbi.nlm.nih.gov / blast). The results showed that the 16S rDNA sequence of W608 was similar to the Bacillus velezensis (MN938176.1), Bacillus siamensis (MN865945.1), and Bacillus amyloliquefaciens (MK182997.1) and other str...
Embodiment 3
[0026] Example 3: Determination of antibacterial spectrum of phytopathogenic fungi
[0027] Bacillus ( Bacillus sp. ) The preparation method of W608 fermentation supernatant is as follows: First, Bacillus ( Bacillus sp. ) W608 was activated and cultured in a test tube containing 5 mL of LB medium, and then the activated strain was inoculated into 500 mL of LB medium for fermentation culture.
[0028] The centrifugation to remove bacterial cells was performed by centrifugation at 10,000 r / min for 20 min.
[0029] The time of the activation culture was 20h.
[0030] The temperature of the fermentation culture is 28°C, the time of the fermentation culture is 48h, and the rotation speed of the shaker for the fermentation culture is 200r / min.
[0031] Determination of Bacillus by the disc method ( Bacillus sp. ) Inhibitory activity of W608 against 8 phytopathogenic fungi. The tested pathogenic fungi were made into colonies with a sterile hole punch, and a colony was picked wit...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com