Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Novel E-type aviadenovirus Fiber fluorescent quantitative PCR detection kit and application thereof

An avian adenovirus, fluorescence quantitative technology, applied in the direction of microbial determination/inspection, DNA/RNA fragment, recombinant DNA technology, etc., can solve problems such as new adenovirus infection, achieve good primer specificity, convenient sampling, good stability Effect

Inactive Publication Date: 2021-01-08
SHANGHAI VETERINARY RES INST CHINESE ACAD OF AGRI SCI
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this new type of adenovirus has a potential risk of infection, and it is necessary to quickly establish an effective and widely applicable laboratory detection method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel E-type aviadenovirus Fiber fluorescent quantitative PCR detection kit and application thereof
  • Novel E-type aviadenovirus Fiber fluorescent quantitative PCR detection kit and application thereof
  • Novel E-type aviadenovirus Fiber fluorescent quantitative PCR detection kit and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Establishment of fluorescent PCR detection method

[0034] Virus strains, standard plasmids

[0035] The AH720-8a strain virus was preserved by our laboratory, and the recombinant plasmid pUC57-Fiber (AH720 8a) was synthesized by Shanghai Sangong.

[0036] Main Reagents and Instruments

[0037] DL 500 DNA Marker, AceQ U + Probe Master Mix was purchased from Novozyme, TIANamp virus genome extraction kit was purchased from QIANGEN; Applied Biosystems QS 5 fluorescent quantitative PCR instrument.

[0038] Primer Design for Standard Plasmid Preparation

[0039] Referring to the 30716~30796 bp of the AH720-8a gene (ID: MN226943.1) in GenBank, the specific primer AH720-8a-F was designed: 5'- GGGAGGTCTAAATTCCCAATCC -3' (SEQ ID No.1), AH720-8a - R : 5'- GTTGTAGACAGTGGACCGTTAG -3' (SEQ ID No.2) and probe AH720-8a-Probe: 5'6 FAM-AGTTGATAACGGCGCACTCGATGT- -3' BHQ1-N (SEQ ID No.3), the target fragment is 114 bp; The molecular weight of the recombinant plasmid pUC57-...

Embodiment 2

[0051] Example 2 Sensitivity and repeatability verification of fluorescent PCR detection method

[0052] will be 2.93×10 8 copies / μL~2.93×10 1 The standard plasmid at the concentration of copies / μL was used as a template to carry out qPCR test according to the optimized reaction conditions, and the detection sensitivity was 2.93×10 8 Copies / μL~2.93×10 2 Copies / μL concentration plasmid was used as a template for qPCR reaction, and each concentration gradient was repeated three times. The standard curve was drawn with the obtained Ct value and the coefficient of variation (CV) was calculated to evaluate the repeatability of the method. The results are shown in Table 3. It can be seen from Table 3 that the CV (the ratio of the standard deviation to the mean) is less than 2%, indicating that the established method has good repeatability and stable results. Depend on figure 2 It can be seen from Table 3 that the lowest plasmid concentration that can be detected by the estab...

Embodiment 3

[0056] Example 3 Specific verification of fluorescent PCR detection method

[0057] DNA or cDNA for common infectious pathogens include: chicken Marek's virus (MDV) Md5 virulent strain, type I duck viral hepatitis virus (DHV), duck Tambusu virus (DTMUV), chicken infectious anemia virus (CIA) , avian Escherichia coli (E.coli), serotype 4 avian adenovirus (FADV-4), Mycoplasma gallisepticum (MG), Mycoplasma gallisepticum (MS), etc. for qPCR detection to evaluate the specificity of primers and probes sex. Depend on image 3 It can be seen that: MDV, DHV, CIA, E.coli, DTMUV, MG, MS, serotype 4 avian adenovirus, and virus-free water are all negative, and only AH720-8a has a fluorescent reporter signal, indicating that the detection method has good specificity. sex.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
PCR efficiencyaaaaaaaaaa
Dilution degreeaaaaaaaaaa
Login to View More

Abstract

The invention provides a novel E-type aviadenovirus Fiber fluorescent quantitative PCR detection kit and an application thereof. A TaqMan probe fluorescent quantitative PCR (qPCR) detection method forE-type aviadenovirus AH720-8a is established, the amplification efficiency is 92%, and a target gene fragment can be effectively amplified. The repeatability and the accuracy are high. Clinical separation sample detection shows that the sensitivity of a method is 10 times higher than that of conventional PCR, and 29.3 copies / [mu] L;10<2> TCID50 / mL the virus amount can be detected at least. The specificity is high, and detection results for other viruses infected with poultry, such as a Marek's disease virus Md5 virulent strain, a duck hepatitis virus type I (DHV-I), a duck Tembusu virus (DTMUV), a chicken infectious anemia virus, an avian enterovirus, FADV-4, chicken mycoplasma gallisepticum (MG),chicken mycoplasma synoviae (MS) and double distilled water, are negative. The establishmentof a diagnosis method can provide a technical means for rapid detection of the viruses, and the kit has important significance for promoting the healthy development of the poultry breeding industry.

Description

technical field [0001] The invention belongs to the technical field of virus nucleic acid detection, and in particular relates to a rapid identification and detection of novel E-type poultry adenovirus Fiber fluorescent quantitative PCR detection kit and its application. Background technique [0002] Adenovirus is a linear DNA virus that was first isolated from the in vitro culture of spontaneously degenerated tonsil by Wallace Rowe et al. in 1953. The diameter of the virus is about 70-90nm, without capsule, and it has an icosahedral symmetrical structure under the electron microscope. , consists of three main capsid structural proteins, including hexon, penton, and spike. The hexon is the main structural protein, which consists of three identical monomers and contains type-specific and Asian-specific epitopes. Among them, the Loop1 sequence region (Hexon L1) in the hexon belongs to the hypervariable region, which is considered to be the main antigenic determinant region in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11
CPCC12Q1/701C12Q1/686C12Q2561/113C12Q2563/107C12Q2545/114
Inventor 陈鸿军孙彤孙竹筠孙海伟梅楠史馨瑾钟秋萍谢振华
Owner SHANGHAI VETERINARY RES INST CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com