Autophagy protein beclin-1 as well as coding gene and application thereof

A technology of beclin-1 and gene, applied in application, genetic engineering, plant genetic improvement, etc., can solve problems that threaten the sustainable development of industries, economic losses, and large-scale death of farmed oysters

Inactive Publication Date: 2021-02-02
SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, with the continuous expansion of the breeding scale and the deterioration of the breeding environment, some serious problems have also appeared. Large-scale deaths of cultured oysters have occurred one after another, which not only caused huge economic losses, but also seriously threatened the sustainable development of the existing industries.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Autophagy protein beclin-1 as well as coding gene and application thereof
  • Autophagy protein beclin-1 as well as coding gene and application thereof
  • Autophagy protein beclin-1 as well as coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] Example 1: Cloning of full-length Beclin-1 gene of Hong Kong oyster

[0017] 1. RNA extraction

[0018] Total RNA was extracted using Trizol (Invitorgen), and the specific steps were as follows: (1) Take 50 mg of Hong Kong oyster tissue in a liquid nitrogen pre-cooled mortar, grind the tissue into powder, and transfer it to a centrifuge tube containing 1 ml Trizol , pipetting, and mixing; (2) Add 200 μL of chloroform, shake vigorously for 40 seconds, and place at room temperature for 5 minutes; (3) Centrifuge at 12,000×g for 10 minutes at 4°C, transfer the supernatant to a new tube; (4) Add 0.5ml of isopropyl (5) centrifuge at 12,000×g for 10 min at 4°C, discard the supernatant; (6) wash the precipitate twice with 75% ethanol; (7) discard the supernatant, add 50 μL DEPC water to dissolve the RNA .

[0019] 2. Cloning of Beclin-1 gene from Hong Kong oyster

[0020] According to the existing transcriptome data, the Beclin-1 partial sequence was screened, and the full-l...

Embodiment 2

[0021] Example 2: Construction of eukaryotic expression vector of Hong Kong oyster Beclin-1 gene and luciferase experiment

[0022] 1. Construction of Hong Kong oyster Beclin-1 gene eukaryotic expression vector: (1) Design a pair of primers covering ChBeclin-1 ORF F1: CGTAGGATCCATGGCAACCATCAAGGTTGA; R1: GATCGTCGACTCACTTGTTGGCGAACTGAG, add BamH-I and SalI sites and protect base; (2) PCR amplification using the above primers; (3) PCR products and pCMV-N-Flag vectors were double-digested with BamH-I and SalI, and the purified enzyme-cleaved products were recovered; (4) ligase The cut PCR fragment and the pCMV-N-Flag vector; (5) transformation, picking positive clones, sequencing to verify that the vector is correct, and performing follow-up experiments to obtain Beclin1-Flag. The empty vector pCMV-N-Flag was used as a control.

[0023] 2. Cell Transfection and Luciferase Assay

[0024] HEK293 cells were seeded in 48-well plates (1×10 5 cells / well), liposomes were co-transfecte...

Embodiment 3

[0025] Example 3: Expression pattern of Hong Kong oyster Beclin-1 under bacterial infection

[0026] The expression pattern of Beclin-1 gene in Hong Kong oysters infected by bacteria was detected by real-time fluorescent quantitative method (qPCR). 200 Hong Kong oysters were equally divided into two groups (four groups), and Vibro alginolyticus (Vibro alginolyticus) and Staphylococcus aureus (Staphylococcus haemolyticus) were resuspended in PBS buffer so that the final concentration was 1×10 9 cfu / mL, with a 1mL syringe, inject 0.1mL of the above-mentioned concentration of Vibrio bacteria into the adductor muscle of Hong Kong oysters, and at the same time inject 0.1mL of PBS buffer into each oyster of the control group, and the blank group does not receive any treatment. 3, 6, 12, 24, 48 and 72 hours after the stimulation, 5 oysters were randomly selected from each group, the hemolymph was extracted, and the hemolymphocytes were collected by centrifugation at 800×g for 5 minut...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an autophagy protein beclin-1 as well as a coding gene and application thereof. The amino acid sequence of the autophagy protein beclin-1 is as shown in SEQ ID NO. 2. A Beclin-1 gene is obtained through identification from crassostrea hongkongensis for the first time, formation of autophagosome can be inhibited by interfering expression of Beclin-1, an NF-kappaB signal channel is inhibited, and infection of vibrio alginolyticus and staphylococcus haemolyticus can be quickly responded. The Beclin-1 plays an important role in immune defense of the crassostrea hongkongensis, and provides application guidance for disease control and disease-resistant breeding of the crassostrea hongkongensis and other mariculture shellfishes.

Description

technical field [0001] The invention relates to the field of applied marine biology technology, and more specifically relates to an autophagy protein Beclin-1, its coding gene and its application. Background technique [0002] Hong Kong oyster (Crassostrea hongkongensis) belongs to the mollusca (Mollusca), bivalve (Bivalvia), pearl oyster (Pterioidae), oyster family (Ostridae), giant oyster (Crassostrea), is an important economic cultured shellfish in my country. kind. It is mainly distributed near the coastal estuaries of Guangxi, Guangdong, Fujian and Hainan in China. Due to its large body, fat flesh, delicious taste and other advantages, its market value is much higher than that of other oysters, with an annual output of more than 1.3 million tons and an output value of 6-8 billion yuan. However, with the continuous expansion of the breeding scale and the deterioration of the breeding environment, some serious problems have also appeared. Large-scale deaths of cultured o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/435C12N15/12A61K45/00A61P31/04
CPCC07K14/43504A61K45/00A61P31/04
Inventor李军周银银张跃环喻子牛
OwnerSOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI