Eucommia ulmoides DIR1 gene MeJA response promoter and application thereof
A promoter and gene technology, applied in the field of genetic engineering, can solve problems such as unreported research and achieve broad application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Embodiment 1, the cloning of promoter fragment
[0039] Genomic DNA of Eucommia ulmoides was extracted by CTAB method. According to the promoter sequence, use Primer Primer 5 and Oligo7 to design 2 specific primers, add restriction enzyme cutting sites and protective bases. Using the Eucommia genome extracted above as a template, high-fidelity polymerase was used to amplify. The amplification system and procedures are shown in Table 1 and Table 2.
[0040] Table 1 Gene promoter amplification system
[0041]
[0042] Table 2 PCR amplification program
[0043]
[0044]
[0045] Among them, the two specific primers are:
[0046] Upstream primer EuDIR1p-F: ACGC GTCGA CACAGGGCTTCTATATCTATGACA, where the underline represents the SalⅠ restriction site, and the protection base is in front of the restriction site.
[0047] Downstream primer EuDIR1p-F: CCG GAATTC AATGAGAGAAAATGGGCTTG, where the underline represents the EcoRI restriction site, and the restriction...
Embodiment 2
[0049] Example 2. Construction of pClone007-DIR1p recombinant vector.
[0050] The PCR amplification product obtained above and the T / A clone (pClone007 Versatile Simple Vector) plasmid were transformed into Escherichia coli DH5α, and positive clones were picked and sequenced.
[0051] Wherein, the connection conditions of the T / A clone are shown in Table 3.
[0052] Table 3 Connection conditions of T / A clone
[0053]
[0054] After mixing the above system gently, connect at room temperature (22-30°C) for 1-5min. The pClone007-DIR1p recombinant vector was obtained. The product after the above ligation was transformed into Escherichia coli according to the following method.
[0055]Take out 50 μL of prepared E. coli DH5α competent cells from the -80°C refrigerator, and thaw on ice; add 10 μL of the ligation product to 50 μL of E. coli DH5α competent cell suspension, mix gently, and place on ice for 30 minutes ;Incubate in a constant temperature water bath at 42°C for 60s...
Embodiment 3
[0057] Embodiment 3, identification and analysis of DIR1 gene promoter sequence
[0058] Using the plant cis-acting element database PlantCARE to make related predictions, it was found that the promoter contained the MYB element involved in the drought response, the CGTCA-motif involved in the methyl jasmonate response, the Myb element involved in the plant stress response, and the anaerobic regulation. The element O2-site and a large number of TATA-box and CAAT-box, etc., have not found any tissue-specific promoter elements in terms of the length cloned so far. Analysis results such as figure 2 And shown in Table 4.
[0059] Table 4 The cis-acting elements in the 5' end regulatory region of DIR1 gene
[0060]
PUM
 Login to View More
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More
 Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



