Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Eucommia ulmoides DIR1 gene MeJA response promoter and application thereof

A promoter and gene technology, applied in the field of genetic engineering, can solve problems such as unreported research and achieve broad application prospects

Active Publication Date: 2021-02-05
GUIZHOU UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no report on the gene regulatory elements of DIR1

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Eucommia ulmoides DIR1 gene MeJA response promoter and application thereof
  • Eucommia ulmoides DIR1 gene MeJA response promoter and application thereof
  • Eucommia ulmoides DIR1 gene MeJA response promoter and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1, the cloning of promoter fragment

[0039] Genomic DNA of Eucommia ulmoides was extracted by CTAB method. According to the promoter sequence, use Primer Primer 5 and Oligo7 to design 2 specific primers, add restriction enzyme cutting sites and protective bases. Using the Eucommia genome extracted above as a template, high-fidelity polymerase was used to amplify. The amplification system and procedures are shown in Table 1 and Table 2.

[0040] Table 1 Gene promoter amplification system

[0041]

[0042] Table 2 PCR amplification program

[0043]

[0044]

[0045] Among them, the two specific primers are:

[0046] Upstream primer EuDIR1p-F: ACGC GTCGA CACAGGGCTTCTATATCTATGACA, where the underline represents the SalⅠ restriction site, and the protection base is in front of the restriction site.

[0047] Downstream primer EuDIR1p-F: CCG GAATTC AATGAGAGAAAATGGGCTTG, where the underline represents the EcoRI restriction site, and the restriction...

Embodiment 2

[0049] Example 2. Construction of pClone007-DIR1p recombinant vector.

[0050] The PCR amplification product obtained above and the T / A clone (pClone007 Versatile Simple Vector) plasmid were transformed into Escherichia coli DH5α, and positive clones were picked and sequenced.

[0051] Wherein, the connection conditions of the T / A clone are shown in Table 3.

[0052] Table 3 Connection conditions of T / A clone

[0053]

[0054] After mixing the above system gently, connect at room temperature (22-30°C) for 1-5min. The pClone007-DIR1p recombinant vector was obtained. The product after the above ligation was transformed into Escherichia coli according to the following method.

[0055]Take out 50 μL of prepared E. coli DH5α competent cells from the -80°C refrigerator, and thaw on ice; add 10 μL of the ligation product to 50 μL of E. coli DH5α competent cell suspension, mix gently, and place on ice for 30 minutes ;Incubate in a constant temperature water bath at 42°C for 60s...

Embodiment 3

[0057] Embodiment 3, identification and analysis of DIR1 gene promoter sequence

[0058] Using the plant cis-acting element database PlantCARE to make related predictions, it was found that the promoter contained the MYB element involved in the drought response, the CGTCA-motif involved in the methyl jasmonate response, the Myb element involved in the plant stress response, and the anaerobic regulation. The element O2-site and a large number of TATA-box and CAAT-box, etc., have not found any tissue-specific promoter elements in terms of the length cloned so far. Analysis results such as figure 2 And shown in Table 4.

[0059] Table 4 The cis-acting elements in the 5' end regulatory region of DIR1 gene

[0060]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a eucommia ulmoides DIR1 gene MeJA response promoter and application thereof. The nucleotide sequence of the promoter is shown as SEQ ID NO: 1. The promoter contains a MeJA response element, expression of a GUS reporter gene in Sanxing tobacco (a specific tobacco variety) can be regulated and controlled after genetic transformation of the MeJA response element into the Sanxing tobacco, and the promoter has no tissue specificity, can promote expression of the GUS gene in buds, roots, stems and leaves of the Sanxing tobacco and has no obvious difference in dyeing degree.Research on the regulation and control mode of the promoter is helpful for research on eucommia ulmoides response stress, and the promoter also has important application in more efficient expression of DIR1 protein and research on lignin synthesis regulation and control.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a eucommia DIR1 gene promoter and its application. Background technique [0002] A promoter is a specific DNA sequence that initiates transcription and is specifically recognized and bound by RNA polymerase. It is the core of gene transcription regulation and can control and regulate the mode, location and intensity of gene expression. Eukaryotic promoters are divided into two regions, the core promoter region and the upstream sequence region. The core promoter region contains transcription initiation sites and TATA-box and other cis-acting elements; the upstream sequence region contains different regulatory expression elements, which are important for gene The efficiency, specificity and activity of transcription play a key role in ensuring the effectiveness and accuracy of gene transcription. According to the different modes of transcription, promoters ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/70C12N15/82C12N15/84C12N1/21A01H5/00A01H6/82C12R1/19C12R1/01
CPCC07K14/415C12N15/70C12N15/8238
Inventor 赵懿琛李紫云李彪赵德刚
Owner GUIZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com