Inducible promoter PCHI and application thereof
A promoter and inducible technology, applied in the research fields of molecular biology and genetic engineering, can solve problems such as waste of energy and protein accumulation, and achieve the effects of avoiding excessive consumption, broad application prospects, and eliminating damage
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1: Cloning and sequence analysis of Lilium Minjiang inducible promoter PCHI
[0022] Using the extracted Genomic DNA of Lilium Minjiang root as a template, the sequence of the promoter PCHI was cloned by PCR with specific primers for amplifying the promoter PCHI (upstream primer: 5'ATCATACGTGTGTCCCCTATCATG3'', downstream primer: 5'GGAATGAAGGGCGAGGGTGG3'). The reaction system (20 μL) was 0.5 μg of Minjiang lily genomic DNA, 2 μL 10×Advantage 2 PCR Buffer, 1.8 μL dNTP Mix (10 mM each), 0.2 μL upstream primer (10 μM), 0.2 μL downstream primer (10 μM), 0.2 μL Advantage 2 PCR Polymerase Mix, 14.6 μL PCR-Grade Water. PCR reaction conditions: 94°C for 5min; 32 cycles of 94°C for 30s, 63°C for 30s, and 72°C for 30s; 72°C for 5min. After PCR, 8 μL was taken for agarose gel electrophoresis to detect the specificity and size of the amplified product.
[0023] The obtained PCR product has only one DNA band, so the PCR product was directly cloned by TA. The kit used was pG...
Embodiment 2
[0024] Example 2: PCHI -GUS Expression vector construction
[0025] The pBI121 multiple cloning site has Hin dIII and Bam HI restriction site, so specific primers for amplifying the promoter were added separately Hin dⅢ and Bam HI recognition site. The E. coli plasmid pGEM-T-PCHI inserted into PCHI and the plant expression vector pBI121 plasmid were extracted using the SanPrep column plasmid DNA mini-extraction kit (Shanghai Sangong), and 1 μL was used for agarose gel electrophoresis to detect the extracted plasmids integrity and concentration. restriction endonuclease Bam HI and Hin dⅢ Carry out double digestion of plasmids pGEM-T-PCHI and pBI121 respectively (100 μL system). The reaction system and operation process are as follows: take 20 μL pGEM-T-PCHI and pBI121 plasmids respectively, add 10 μL 10×H buffer, 5 μL Bam HI, 5 μL Hin dⅢ, 60μL ddH 2 O, after mixing, centrifuge for a short time, and place at 37°C for overnight reaction. All digested products ...
Embodiment 3
[0028] Example 3: Plant genetic transformation mediated by Agrobacterium and screening of transgenic plants
[0029] The transgenic recipient in this experiment is tobacco. Soak the tobacco seeds in 75% alcohol for 30s, wash them with sterile water and wash them with 0.1% HgCl 2 Soak for 8 minutes, then wash several times with sterile water, sow on 1 / 2 MS medium, culture in dark at 28°C for 5-8d, transfer to light incubator (25°C, 16h / d light) after germination, and then Subculture once a month with MS medium.
[0030] Store pBI121-PCHI in the -80°C refrigerator -GUS The plasmid Agrobacterium LBA4404 bacterial liquid was taken out, and 10 μL of the bacterial liquid was inoculated into 1 mL of LB liquid medium containing 20 mg / L rifampicin and 50 mg / L kanamycin, and cultured at 28°C with shaking at 200 rpm until turbid. Pipette 500 μL of bacterial liquid and evenly spread it on LB solid medium containing 20 mg / L rifampicin and 50 mg / L kanamycin, and culture it upside down at...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com