Check patentability & draft patents in minutes with Patsnap Eureka AI!

Inducible promoter PCHI and application thereof

A promoter and inducible technology, applied in the research fields of molecular biology and genetic engineering, can solve problems such as waste of energy and protein accumulation, and achieve the effects of avoiding excessive consumption, broad application prospects, and eliminating damage

Active Publication Date: 2021-04-06
KUNMING UNIV OF SCI & TECH
View PDF9 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In genetic engineering, if the foreign gene transferred to the plant is not controlled, it will be expressed in large quantities in the plant, resulting in a large amount of protein accumulation and a waste of energy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Inducible promoter PCHI and application thereof
  • Inducible promoter PCHI and application thereof
  • Inducible promoter PCHI and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1: Cloning and sequence analysis of Lilium Minjiang inducible promoter PCHI

[0022] Using the extracted Genomic DNA of Lilium Minjiang root as a template, the sequence of the promoter PCHI was cloned by PCR with specific primers for amplifying the promoter PCHI (upstream primer: 5'ATCATACGTGTGTCCCCTATCATG3'', downstream primer: 5'GGAATGAAGGGCGAGGGTGG3'). The reaction system (20 μL) was 0.5 μg of Minjiang lily genomic DNA, 2 μL 10×Advantage 2 PCR Buffer, 1.8 μL dNTP Mix (10 mM each), 0.2 μL upstream primer (10 μM), 0.2 μL downstream primer (10 μM), 0.2 μL Advantage 2 PCR Polymerase Mix, 14.6 μL PCR-Grade Water. PCR reaction conditions: 94°C for 5min; 32 cycles of 94°C for 30s, 63°C for 30s, and 72°C for 30s; 72°C for 5min. After PCR, 8 μL was taken for agarose gel electrophoresis to detect the specificity and size of the amplified product.

[0023] The obtained PCR product has only one DNA band, so the PCR product was directly cloned by TA. The kit used was pG...

Embodiment 2

[0024] Example 2: PCHI -GUS Expression vector construction

[0025] The pBI121 multiple cloning site has Hin dIII and Bam HI restriction site, so specific primers for amplifying the promoter were added separately Hin dⅢ and Bam HI recognition site. The E. coli plasmid pGEM-T-PCHI inserted into PCHI and the plant expression vector pBI121 plasmid were extracted using the SanPrep column plasmid DNA mini-extraction kit (Shanghai Sangong), and 1 μL was used for agarose gel electrophoresis to detect the extracted plasmids integrity and concentration. restriction endonuclease Bam HI and Hin dⅢ Carry out double digestion of plasmids pGEM-T-PCHI and pBI121 respectively (100 μL system). The reaction system and operation process are as follows: take 20 μL pGEM-T-PCHI and pBI121 plasmids respectively, add 10 μL 10×H buffer, 5 μL Bam HI, 5 μL Hin dⅢ, 60μL ddH 2 O, after mixing, centrifuge for a short time, and place at 37°C for overnight reaction. All digested products ...

Embodiment 3

[0028] Example 3: Plant genetic transformation mediated by Agrobacterium and screening of transgenic plants

[0029] The transgenic recipient in this experiment is tobacco. Soak the tobacco seeds in 75% alcohol for 30s, wash them with sterile water and wash them with 0.1% HgCl 2 Soak for 8 minutes, then wash several times with sterile water, sow on 1 / 2 MS medium, culture in dark at 28°C for 5-8d, transfer to light incubator (25°C, 16h / d light) after germination, and then Subculture once a month with MS medium.

[0030] Store pBI121-PCHI in the -80°C refrigerator -GUS The plasmid Agrobacterium LBA4404 bacterial liquid was taken out, and 10 μL of the bacterial liquid was inoculated into 1 mL of LB liquid medium containing 20 mg / L rifampicin and 50 mg / L kanamycin, and cultured at 28°C with shaking at 200 rpm until turbid. Pipette 500 μL of bacterial liquid and evenly spread it on LB solid medium containing 20 mg / L rifampicin and 50 mg / L kanamycin, and culture it upside down at...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an inducible promoter PCHI which is derived from lilium regale. The nucleotide sequence of the inducible promoter PCHI is shown as SEQ ID NO: 1. According to the invention, technical research related to molecular biology and genetic engineering proves that the lilium regale promoter PCHI responds to jasmonic acid methyl ester and biological stress. An expression cassette constructed by the lilium regale promoter PCHI and a beta-glucosidase gene is transferred into tobacco for expression, and the glucosidase activity of the obtained transgenic tobacco is quantitatively detected through a fluorescence method; and results show that after the transgenic tobacco is treated with jasmonic acid methyl ester, fusarium oxysporum, fusarium solani and sporotrichum oryzae treatment, the glucosidase activity of the transgenic tobacco is obviously enhanced. The lilium regale promoter PCHI is induced by jasmonic acid methyl ester and biological stress factors and can be used in disease-resistant gene engineering of plants.

Description

technical field [0001] The invention relates to the research fields of molecular biology and genetic engineering, in particular to an inducible promoter PCHI and its application. Background technique [0002] A promoter is a DNA sequence located upstream of a gene that can be specifically recognized by RNA polymerase. It is like a "switch" that controls the onset and extent of gene expression. The promoter composition includes the core promoter and upstream promoter elements. The core promoter consists of a transcription initiation site, a TATA box, and a 5'UTR sequence. Upstream promoter elements include CAAT box, GC box, and some constitutive and specific elements, which can improve transcription efficiency by binding corresponding protein factors. Promoters can be divided into constitutive promoters (gene expression is not controlled by time and space and external factors) and inducible promoters (gene expression is induced by exogenous physical and chemical factors, w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/84A01H5/00A01H6/82
CPCC07K14/415C12N15/8238C12N15/8239C12N15/8212
Inventor 刘迪秋李珊王自娥苏琳琳梁婷婷邓婕葛锋
Owner KUNMING UNIV OF SCI & TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More