Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Lilium regale inducible promoter PG1 and application thereof

A promoter, inducible technology, applied in the research fields of molecular biology and genetic engineering, which can solve problems such as disorder, excessive accumulation of gene products and metabolism, abnormal development, etc.

Active Publication Date: 2021-04-27
KUNMING UNIV OF SCI & TECH
View PDF11 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of the constitutive promoters used in traditional genetic engineering are highly expressed throughout the life cycle of plants, resulting in excessive accumulation of gene products and subsequent metabolic disorders, which may even produce severe developmental abnormalities

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lilium regale inducible promoter PG1 and application thereof
  • Lilium regale inducible promoter PG1 and application thereof
  • Lilium regale inducible promoter PG1 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1: Cloning and sequence analysis of Lilium Minjiang inducible promoter PG1

[0022] Using the extracted Genomic DNA of Lily of the Minjiang River as a template, use specific primers for amplifying the promoter PG1 (the upstream primer is: 5'GCCCCATAGACCCCTATCCAAGTA3'', the downstream primer is: 5'CAGGGGCAGAGGGTTGAC3', and the sequence of the promoter PG1 is cloned by PCR. Reaction The system (20 μL) is 0.5 μg of Minjiang Lily genomic DNA, 2 μL 10×Advantage 2 PCR Buffer, 1.8 μL dNTP Mix (10 mM each), 0.2 μL upstream primer (10 μM), 0.2 μL downstream primer (10 μM), 0.2 μL Advantage 2 PCR Polymerase Mix, 14.6 μL PCR-Grade water. PCR reaction conditions: 94°C for 5 minutes; 94°C for 30s, 63°C for 30s, 72°C for 50s, 32 cycles; 72°C for 5min. After PCR, take 8μL for agarose gel Electrophoresis to detect the specificity and size of the amplified product.

[0023] The PCR product obtained has only one DNA band, and the PCR product is directly cloned by TA. The kit use...

Embodiment 2

[0024] Example 2: PG1 -GUS Expression vector construction

[0025] The pBI121 multiple cloning site has Hin dⅢ and Bam HI restriction sites, so specific primers for amplifying promoters were added Hin dⅢ and Bam HI recognition site. The E. coli plasmid pGEM-T-PG1 inserted into PG1 and the plant expression vector pBI121 plasmid were extracted using the SanPrep column plasmid DNA mini-extraction kit (Shanghai Sangong), and 1 μL was used for agarose gel electrophoresis to detect the extracted plasmids integrity and concentration. restriction endonuclease Hin dⅢ and Bam HI performed double enzyme digestion on plasmids pGEM-T-PG1 and pBI121 respectively (5μL system). The reaction system and operation process were as follows: take 20μL pGEM-T-PG1 and pBI121 plasmids respectively, add 10μL 10×H buffer, 5μL Bam HI, 5 μL Hin dIII, 60 μL ddH 2 O, after mixing, centrifuge for a short time, and place at 37°C for overnight reaction. All digested products were subjected ...

Embodiment 3

[0028] Example 3: Plant genetic transformation mediated by Agrobacterium and screening of transgenic plants

[0029] The transgenic recipient in this experiment is tobacco. Soak the tobacco seeds in 75% alcohol for 30s, wash them with sterile water and wash them with 0.1% HgCl 2 Soak for 8 minutes, then wash several times with sterile water, sow on 1 / 2 MS medium, culture in dark at 28°C for 5-8d, transfer to light incubator (25°C, 16h / d light) after germination, and then Subculture once a month with MS medium.

[0030] Store the pBI121-PG1 containing pBI121-PG1 in the -80℃ refrigerator -GUS The plasmid Agrobacterium LBA4404 bacterial liquid was taken out, and 10 μL of the bacterial liquid was inoculated into 1 mL of LB liquid medium containing 20 mg / L rifampicin and 50 mg / L kanamycin, and cultured with shaking at 28°C and 200 rpm until turbid. Pipette 500 μL of bacterial liquid and evenly spread it on LB solid medium containing 20 mg / L rifampicin and 50 mg / L kanamycin, and ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a lilium regale inducible promoter PG1. A nucleotide sequence of the lilium regale inducible promoter PG1 is as shown in SEQ ID NO:1. According to the invention, molecular biology and genetic engineering related technical researches prove that the lilium regale inducible promoter PG1 responds to a few plant hormones, organisms and abiotic stresses; a fusion expression cassette constructed by the lilium regale promoter PG1 and a beta-glucosidase gene is transferred into tobacco to be expressed; the glucosidase activity of transgenic tobacco is quantitatively detected through a fluorescence method; a result shows that after abscisic acid, salicylic acid, fusarium oxysporum, nigrospora oryzae, alternaria compact and damage stress treatment, the glucosidase activity of the transgenic tobacco is obviously enhanced; and the lilium regale promoter PG1 is induced by a few plant hormones, organisms and abiotic stress factors, and has a wide application prospect in biological or abiotic stress resistant genetic engineering.

Description

technical field [0001] The invention relates to the research fields of molecular biology and genetic engineering, in particular to a Minjiang lily inducible promoter PG1 and its application. Background technique [0002] A promoter is a DNA sequence located in the upstream region of a gene that regulates gene transcription. It is an important cis-regulatory factor that determines the temporal and spatial accuracy and transcription efficiency of gene transcription, thereby regulating the expression of downstream genes. The promoter composition includes the core promoter and upstream promoter elements. The core promoter consists of a transcription initiation site, a TATA box, and a 5'UTR sequence. Upstream promoter elements include CAAT box, GC box, and some constitutive and specific elements, which can improve transcription efficiency by binding corresponding protein factors. The promoters of plant genes can be divided into constitutive promoters, inducible promoters and ti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/84A01H5/00A01H6/82
CPCC07K14/415C12N15/8237
Inventor 刘迪秋王自娥邓婕梁婷婷苏琳琳曲媛
Owner KUNMING UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com