Lilium regale inducible promoter PG1 and application thereof
A promoter, inducible technology, applied in the research fields of molecular biology and genetic engineering, which can solve problems such as disorder, excessive accumulation of gene products and metabolism, abnormal development, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1: Cloning and sequence analysis of Lilium Minjiang inducible promoter PG1
[0022] Using the extracted Genomic DNA of Lily of the Minjiang River as a template, use specific primers for amplifying the promoter PG1 (the upstream primer is: 5'GCCCCATAGACCCCTATCCAAGTA3'', the downstream primer is: 5'CAGGGGCAGAGGGTTGAC3', and the sequence of the promoter PG1 is cloned by PCR. Reaction The system (20 μL) is 0.5 μg of Minjiang Lily genomic DNA, 2 μL 10×Advantage 2 PCR Buffer, 1.8 μL dNTP Mix (10 mM each), 0.2 μL upstream primer (10 μM), 0.2 μL downstream primer (10 μM), 0.2 μL Advantage 2 PCR Polymerase Mix, 14.6 μL PCR-Grade water. PCR reaction conditions: 94°C for 5 minutes; 94°C for 30s, 63°C for 30s, 72°C for 50s, 32 cycles; 72°C for 5min. After PCR, take 8μL for agarose gel Electrophoresis to detect the specificity and size of the amplified product.
[0023] The PCR product obtained has only one DNA band, and the PCR product is directly cloned by TA. The kit use...
Embodiment 2
[0024] Example 2: PG1 -GUS Expression vector construction
[0025] The pBI121 multiple cloning site has Hin dⅢ and Bam HI restriction sites, so specific primers for amplifying promoters were added Hin dⅢ and Bam HI recognition site. The E. coli plasmid pGEM-T-PG1 inserted into PG1 and the plant expression vector pBI121 plasmid were extracted using the SanPrep column plasmid DNA mini-extraction kit (Shanghai Sangong), and 1 μL was used for agarose gel electrophoresis to detect the extracted plasmids integrity and concentration. restriction endonuclease Hin dⅢ and Bam HI performed double enzyme digestion on plasmids pGEM-T-PG1 and pBI121 respectively (5μL system). The reaction system and operation process were as follows: take 20μL pGEM-T-PG1 and pBI121 plasmids respectively, add 10μL 10×H buffer, 5μL Bam HI, 5 μL Hin dIII, 60 μL ddH 2 O, after mixing, centrifuge for a short time, and place at 37°C for overnight reaction. All digested products were subjected ...
Embodiment 3
[0028] Example 3: Plant genetic transformation mediated by Agrobacterium and screening of transgenic plants
[0029] The transgenic recipient in this experiment is tobacco. Soak the tobacco seeds in 75% alcohol for 30s, wash them with sterile water and wash them with 0.1% HgCl 2 Soak for 8 minutes, then wash several times with sterile water, sow on 1 / 2 MS medium, culture in dark at 28°C for 5-8d, transfer to light incubator (25°C, 16h / d light) after germination, and then Subculture once a month with MS medium.
[0030] Store the pBI121-PG1 containing pBI121-PG1 in the -80℃ refrigerator -GUS The plasmid Agrobacterium LBA4404 bacterial liquid was taken out, and 10 μL of the bacterial liquid was inoculated into 1 mL of LB liquid medium containing 20 mg / L rifampicin and 50 mg / L kanamycin, and cultured with shaking at 28°C and 200 rpm until turbid. Pipette 500 μL of bacterial liquid and evenly spread it on LB solid medium containing 20 mg / L rifampicin and 50 mg / L kanamycin, and ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap