Lilium regale inducible promoter PD1 and application thereof
A promoter and inducible technology, applied in the research fields of molecular biology and genetic engineering, can solve problems such as waste of energy and protein accumulation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1: Cloning and sequence analysis of Lilium Minjiang inducible promoter PD1
[0022] Using the extracted Genomic DNA of Lilium Minjiang root as a template, the sequence of promoter PD1 was cloned by PCR with specific primers for amplifying promoter PD1 (upstream primer: 5'TAACGCATTGCTCCCCACA3'', downstream primer: 5'GGGTTTTGGTTGAAGGATAG3'). The reaction system (20 μL) is 0.5 μg of Genomic DNA of Lily Minjiang River, 2 μL of 10×Advantage 2 PCRBuffer, 1.8 μL of dNTP Mix (10 mM each), 0.2 μL of upstream primer (10 μM), 0.2 μL of downstream primer (10 μM), 0.2 μL of Advantage 2 PCR Polymerase Mix, 14.6μL PCR-Grade water. PCR reaction conditions: 94°C for 5min; 32 cycles of 94°C for 30s, 63°C for 30s, 72°C for 50s; 72°C for 5min. After PCR, 8 μL was taken for agarose gel electrophoresis to detect the specificity and size of the amplified product.
[0023] Then TA clone the PCR product, the kit used is pGEM-T vector system (Promega), the reaction system and operation...
Embodiment 2
[0024] Example 2: PD1 -GUS Fusion expression vector construction
[0025] The pBI121 multiple cloning site has Sca I and Xba Ⅰ restriction site, so the specific primers for the amplification of the promoter were added Sca I and Xba I recognition site. The E. coli plasmid pGEM-T-PD1 inserted into PD1 and the plant expression vector pBI121 plasmid were extracted using the SanPrep column plasmid DNA mini-extraction kit (Shanghai Sangong), and 1 μL was used for agarose gel electrophoresis to detect the extracted plasmids integrity and concentration. restriction endonuclease Sca I and Xba Ⅰ Carry out double digestion of plasmids pGEM-T-PD1 and pBI121 respectively (5μL system). The reaction system and operation process are as follows: take 15μL pGEM-T-PD1 and pBI121 plasmids respectively, add 3μL 10×H buffer, 2μL Sca I, 5 μL ddH 2 O, mix well and centrifuge for a short time, place at 37°C for 2 hours, then add 5 μL 10×M buffer, 2 μL Xba I. 13 μL ddH 2 O, after mi...
Embodiment 3
[0028] Example 3: Plant genetic transformation mediated by Agrobacterium and screening of transgenic plants
[0029] The transgenic recipient in this experiment is tobacco. Soak the tobacco seeds in 75% alcohol for 30s, wash them with sterile water and wash them with 0.1% HgCl 2 Soak for 8 minutes, then wash several times with sterile water, sow on 1 / 2 MS medium, culture in dark at 28°C for 5-8d, transfer to light incubator (25°C, 16h / d light) after germination, and then Subculture once a month with MS medium.
[0030] Store the pBI121-PD1 containing pBI121-PD1 in the -80℃ refrigerator -GUS The plasmid Agrobacterium LBA4404 bacterial liquid was taken out, and 10 μL of the bacterial liquid was inoculated into 1 mL of LB liquid medium containing 20 mg / L rifampicin and 50 mg / L kanamycin, and cultured with shaking at 28°C and 200 rpm until turbid. Pipette 500 μL of bacterial liquid and evenly spread it on LB solid medium containing 20 mg / L rifampicin and 50 mg / L kanamycin, and ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap