Unlock instant, AI-driven research and patent intelligence for your innovation.

Lilium regale inducible promoter PD1 and application thereof

A promoter and inducible technology, applied in the research fields of molecular biology and genetic engineering, can solve problems such as waste of energy and protein accumulation

Active Publication Date: 2021-05-28
KUNMING UNIV OF SCI & TECH
View PDF9 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In genetic engineering, if the foreign gene transferred to the plant is not controlled, it will be expressed in large quantities in the plant, resulting in a large amount of protein accumulation and a waste of energy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lilium regale inducible promoter PD1 and application thereof
  • Lilium regale inducible promoter PD1 and application thereof
  • Lilium regale inducible promoter PD1 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1: Cloning and sequence analysis of Lilium Minjiang inducible promoter PD1

[0022] Using the extracted Genomic DNA of Lilium Minjiang root as a template, the sequence of promoter PD1 was cloned by PCR with specific primers for amplifying promoter PD1 (upstream primer: 5'TAACGCATTGCTCCCCACA3'', downstream primer: 5'GGGTTTTGGTTGAAGGATAG3'). The reaction system (20 μL) is 0.5 μg of Genomic DNA of Lily Minjiang River, 2 μL of 10×Advantage 2 PCRBuffer, 1.8 μL of dNTP Mix (10 mM each), 0.2 μL of upstream primer (10 μM), 0.2 μL of downstream primer (10 μM), 0.2 μL of Advantage 2 PCR Polymerase Mix, 14.6μL PCR-Grade water. PCR reaction conditions: 94°C for 5min; 32 cycles of 94°C for 30s, 63°C for 30s, 72°C for 50s; 72°C for 5min. After PCR, 8 μL was taken for agarose gel electrophoresis to detect the specificity and size of the amplified product.

[0023] Then TA clone the PCR product, the kit used is pGEM-T vector system (Promega), the reaction system and operation...

Embodiment 2

[0024] Example 2: PD1 -GUS Fusion expression vector construction

[0025] The pBI121 multiple cloning site has Sca I and Xba Ⅰ restriction site, so the specific primers for the amplification of the promoter were added Sca I and Xba I recognition site. The E. coli plasmid pGEM-T-PD1 inserted into PD1 and the plant expression vector pBI121 plasmid were extracted using the SanPrep column plasmid DNA mini-extraction kit (Shanghai Sangong), and 1 μL was used for agarose gel electrophoresis to detect the extracted plasmids integrity and concentration. restriction endonuclease Sca I and Xba Ⅰ Carry out double digestion of plasmids pGEM-T-PD1 and pBI121 respectively (5μL system). The reaction system and operation process are as follows: take 15μL pGEM-T-PD1 and pBI121 plasmids respectively, add 3μL 10×H buffer, 2μL Sca I, 5 μL ddH 2 O, mix well and centrifuge for a short time, place at 37°C for 2 hours, then add 5 μL 10×M buffer, 2 μL Xba I. 13 μL ddH 2 O, after mi...

Embodiment 3

[0028] Example 3: Plant genetic transformation mediated by Agrobacterium and screening of transgenic plants

[0029] The transgenic recipient in this experiment is tobacco. Soak the tobacco seeds in 75% alcohol for 30s, wash them with sterile water and wash them with 0.1% HgCl 2 Soak for 8 minutes, then wash several times with sterile water, sow on 1 / 2 MS medium, culture in dark at 28°C for 5-8d, transfer to light incubator (25°C, 16h / d light) after germination, and then Subculture once a month with MS medium.

[0030] Store the pBI121-PD1 containing pBI121-PD1 in the -80℃ refrigerator -GUS The plasmid Agrobacterium LBA4404 bacterial liquid was taken out, and 10 μL of the bacterial liquid was inoculated into 1 mL of LB liquid medium containing 20 mg / L rifampicin and 50 mg / L kanamycin, and cultured with shaking at 28°C and 200 rpm until turbid. Pipette 500 μL of bacterial liquid and evenly spread it on LB solid medium containing 20 mg / L rifampicin and 50 mg / L kanamycin, and ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a lilium regale inducible promoter PD1 and application thereof, the nucleotide sequence of the inducible promoter PD1 is shown as SEQ ID NO:1, and the lilium regale inducible promoter PD1 is proved to respond to several plant hormones, biological stress and abiotic stress through molecular biology and genetic engineering related technical research; a fusion gene expression cassette constructed by the lilium regale promoter PD1 and a [beta]-glucuronidase gene is transferred into tobacco for expression, and the glucuronidase activity of transgenic tobacco is quantitatively detected through adoption of a fluorescence method. Results show that after the transgenic tobacco is treated by abscisic acid, salicylic acid, methyl jasmonate, gibberellin, ethephon, fusarium solani, injury stress and sodium chloride, the activity of glucosidase is obviously enhanced; and the inducible promoter PD1 disclosed by the invention has a wide application prospect in genetic engineering for resisting biological or abiotic stress.

Description

technical field [0001] The invention relates to the research fields of molecular biology and genetic engineering, in particular to an inducible promoter PD1 and its application. Background technique [0002] A promoter is a DNA sequence and related regulatory elements that provide RNA polymerase recognition and binding, usually located upstream of a gene, to stimulate or repress gene transcription. The promoter composition includes the core promoter and upstream promoter elements. The core promoter consists of a transcription initiation site, a TATA box, and a 5' untranslated region sequence. Upstream promoter elements include CAAT box, GC box, and some constitutive and specific elements, which can improve transcription efficiency by binding corresponding protein factors. Promoters can be divided into three categories according to their functions and modes of action: constitutive promoters (gene expression is not controlled by time and space constraints and external factor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/84A01H5/00A01H6/82
CPCC07K14/415C12N15/8237
Inventor 刘迪秋王自娥邓婕苏琳琳梁婷婷曲媛葛锋
Owner KUNMING UNIV OF SCI & TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More