Low-temperature exoinulinase mutant MutDL121EK5 with improved low-temperature adaptability and application thereof

An exo-inulinase and mutant technology, which is applied in the field of genetic engineering and can solve the problems of easy degradation of enzymes and easy exposure of protease cleavage sites.

Active Publication Date: 2021-05-28
YUNNAN NORMAL UNIV
View PDF15 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In order to control the catalytic reaction of enzymes conveniently and effectively, enzymes that are easy to heat denature are needed; at the same time, in order to make the use of enzymes safer, it is necessary for enzymes to be easily degraded after simple treatment, and heat denaturation makes enzymes easy to expose protease enzymes cleavage site, causing the enzyme to be easily degraded

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Low-temperature exoinulinase mutant MutDL121EK5 with improved low-temperature adaptability and application thereof
  • Low-temperature exoinulinase mutant MutDL121EK5 with improved low-temperature adaptability and application thereof
  • Low-temperature exoinulinase mutant MutDL121EK5 with improved low-temperature adaptability and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Construction and Transformation of Embodiment 1 Wild Enzyme InuAMN8 Expression Vector

[0035] 1) Extraction of Arthrobacter genomic DNA: Centrifuge the bacterial liquid cultured for 2 days to obtain the bacterial cells, add 1 mL of lysozyme, treat at 37°C for 60 minutes, and then follow the instructions of the bacterial genomic DNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.) Genomic DNA of Arthrobacter was extracted and stored at -20°C for later use.

[0036] 2) According to the exo-inulinase nucleotide sequence JQ863111 (SEQID NO.4) recorded in GenBank, primers 5'ATGAATTCATTGACGACGGC 3' and 5'TCAACGGCCGACGACGTCGA 3' were designed, and the Arthrobacter genomic DNA was used as a template for PCR amplification. The reaction parameters are: denaturation at 95°C for 5 min; then denaturation at 95°C for 30 sec, annealing at 58°C for 30 sec, extension at 72°C for 1 min and 30 sec, and after 30 cycles, keep at 72°C for 5 min. The PCR results obtained ...

Embodiment 2

[0039] Construction and transformation of embodiment 2 mutant enzyme MutDL121EK5 expression vector

[0040] 1) Design primers 5'TGAAGAAGACCGAAAGCCGGGCCGGCAGGCGCAG 3' and 5'GCTTTCGGTCTTTCCTACTGTAGGCACTGGTGTAAATGGC 3', and use the plasmid pEasy-E1-inuAMN8 as a template for PCR amplification. The PCR reaction parameters are: denaturation at 95°C for 30 sec; denaturation at 95°C for 15 sec, annealing at 70°C for 15 sec , extend at 72°C for 3min 30sec, and after 30 cycles, keep at 72°C for 5min. As a result of PCR, the recombinant expression linearized plasmid pEasy-E1-mutDL121EK5 containing mutDL121EK5 was obtained. mutDL121EK5 and pEasy-E1-mutDL121EK5 can also be obtained by gene synthesis.

[0041] 2) Add 1 μL of DpnI enzyme to 50 μL of the PCR product of the linearized plasmid pEasy-E1-mutDL121EK5, and digest it at 37° C. for 1 h.

[0042] 3) Use Mut II Fast Mutagenesis Kit, place the digested product in (2) at 37°C for 30min.

[0043] 4) The ligation product in (3) was tr...

Embodiment 3

[0044] Embodiment 3 Preparation of recombinant wild enzyme InuAMN8 and mutant enzyme MutDL121EK5

[0045] The recombinant strains BL21(DE3) / inuAMN8 and BL21(DE3) / mutDL121EK5 were inoculated in LB (containing 100 μg mL -1 Amp) medium, shake rapidly at 37°C for 16h.

[0046] Then the activated bacterial solution was inoculated into fresh LB (containing 100 μg mL -1 Amp) culture solution, after rapid shaking culture for about 2-3 hours (OD600 reaches 0.6-1.0), add IPTG with a final concentration of 0.7mM for induction, and continue shaking culture at 20°C for about 20 hours. Centrifuge at 12000rpm for 5min to collect the bacteria. After suspending the cells with an appropriate amount of McIlvaine buffer with pH=7.0, the cells were ultrasonically disrupted in a low-temperature water bath. After the crude enzyme solution concentrated in the cells was centrifuged at 13,000 rpm for 10 min, the supernatant was aspirated and the target protein was affinity-purified with Nickel-NTAAg...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of gene engineering and protein modification, and discloses a low-temperature exoinulinase mutant MutDL121EK5 with improved low-temperature adaptability and application thereof, the amino acid sequence of the mutant MutDL121EK5 is obtained by replacing DAAPL from the 121st site to the 125th site of wild exoinulinase InuAMN8 with five amino acids EEDRK, and the sequence of the MutDL121EK5 is shown as SEQ ID NO.1. Compared with a wild enzyme InuAMN8, the mutant enzyme MutDL121EK5 has the advantages that the low-temperature activity is improved, the mutant enzyme MutDL121EK5 is more easily subjected to thermal denaturation, the improvement of the low-temperature activity is beneficial to reducing the dosage of the enzyme or shortening the reaction time during low-temperature reaction, and the easy thermal denaturation is beneficial to controlling the reaction process of the enzyme through thermal treatment. The low-temperature exoinulinase mutant MutDL121EK5 disclosed by the invention can be applied to the industries of food, wine brewing, washing and the like.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering and relates to protein transformation technology, in particular to a low-temperature exo-inulinase mutant MutDL121EK5 with improved low-temperature adaptability and its application. Background technique [0002] Jerusalem artichoke can be planted in most areas of our country. It is a high-density non-grain energy crop, which is resistant to drought, barrenness, salt and alkali, and has high yield. In the dry matter of Jerusalem artichoke tubers, the inulin content can be as high as 70%, and these characteristics make the effective utilization of Jerusalem artichoke become the focus of attention. [0003] Inulin is a polysaccharide formed by the polymerization of fructose. After hydrolysis by exo-inulinase, fructose syrup with a sugar content of up to 95% can be obtained. Fructose is widely used in food, medicine, bio-energy and other industries. It can be used as a natural sweetener t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/24C12N15/56C12N15/70C12N1/21C12R1/19
CPCC12N9/2402C12Y302/01007C12N15/70Y02A50/30
Inventor张蕊周峻沛黄遵锡岑潇龙许波韩楠玉唐湘华李俊俊吴倩高艳秀
OwnerYUNNAN NORMAL UNIV