Chitin deacetylase protein crystals
A deacetylase protein and deacetylase technology are applied in the field of chitin deacetylase protein crystal and preparation, and can solve problems such as limiting the development of plant antibacterial agents.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Embodiment 1: the preparation method of high-purity Verticillium dahliae chitin deacetylase VdPDA1
[0036] 1. Preparation of VdPDA1 expressing bacteria
[0037] 1) Cloning of the target gene
[0038] Design specific primers according to the cDNA sequence of VdPDA1, and use PCR amplification to obtain the target fragment sequence (SEQ ID NO: 2), wherein the primer sequence is: PDA-N: 5'- CTGAAGCTTACGTAGAATTC TCGCCCATCACCAAGGACCT-3'; EcoR I restriction site in pPIC9 and the first 14bp sequence of the site added to the N-terminal; PDA-C: 5'- CGGCCGCCCTAGGGAATTCTCA ATGATGATGATGATGATG AGCGCGGGGAGTGACCCTGT-3'; 6 histidine tags, stop codon seeds, EcoR1 restriction site in pPIC9 and 13bp sequence after the site were added to the C-terminus.
[0039] 2) Construction of expression vector
[0040] After the pPIC9 was digested by EcoR I, it was connected with the target fragment by homologous recombination under the action of In-Fusion enzyme. The ligation product was tran...
Embodiment 2
[0051] Example 2: Crystal preparation and structural analysis of Verticillium dahliae chitin deacetylase VdPDA1
[0052] 1. Screening of VdPDA1 protein crystallization conditions
[0053] 1) Primary screening of crystallization conditions
[0054] The protein was concentrated to 10 mg / mL. The hanging drop method was used to screen the protein crystallization conditions. Seven commercial crystallization kits were used for the initial screening of the crystal conditions, including Index, CrystalScreen, Crystal Screen 2 produced by Hampton Research, Wizard 1 produced by Rigak Reagents. and Wizard 2, as well as Protein Complex Suite and JCSG+Suite produced by Qiagen. A total of 480 crystallization conditions are included, which are distributed into 24-well crystal culture plates as pool liquid for use. Then take 1 μL of the target protein and 1 μL of the pool solution and mix it on the silanized coverslip. Invert the coverslip on the upper interface of the crystal culture plate...
Embodiment 3
[0063] Example 3: Antibacterial agent design method based on plant soil-borne pathogenic fungal chitin deacetylase protein structure
[0064] 1. Select the ZINC database containing about 4 million commercial compounds as the virtual screening compound library, and use Autodockvina molecular docking software to perform virtual screening of the compounds in the ZINC database for shape and electrical similarity:
[0065] 1) Shape similarity screening: Using the molecular conformation of the smallest length substrate in the complex structure of VdPDA1 and chitin oligosaccharide as a template, the three-dimensional structure of the compound was generated by the Omega program, and the ROCS program was used to calculate the molecular shape of the compound structure and the template in the database. Similarity, compounds were sorted by TanimotoCombo score to determine the top 1000 scoring compounds.
[0066] 2) Electrical similarity screening: Use the EON program to perform charge sim...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


