Unlock instant, AI-driven research and patent intelligence for your innovation.

Chitin deacetylase protein crystals

A deacetylase protein and deacetylase technology are applied in the field of chitin deacetylase protein crystal and preparation, and can solve problems such as limiting the development of plant antibacterial agents.

Active Publication Date: 2022-06-03
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the structure of chitin deacetylase of plant soil-borne pathogenic fungi has not been reported, which greatly limits the development of plant antibacterial agents

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chitin deacetylase protein crystals
  • Chitin deacetylase protein crystals
  • Chitin deacetylase protein crystals

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1: the preparation method of high-purity Verticillium dahliae chitin deacetylase VdPDA1

[0036] 1. Preparation of VdPDA1 expressing bacteria

[0037] 1) Cloning of the target gene

[0038] Design specific primers according to the cDNA sequence of VdPDA1, and use PCR amplification to obtain the target fragment sequence (SEQ ID NO: 2), wherein the primer sequence is: PDA-N: 5'- CTGAAGCTTACGTAGAATTC TCGCCCATCACCAAGGACCT-3'; EcoR I restriction site in pPIC9 and the first 14bp sequence of the site added to the N-terminal; PDA-C: 5'- CGGCCGCCCTAGGGAATTCTCA ATGATGATGATGATGATG AGCGCGGGGAGTGACCCTGT-3'; 6 histidine tags, stop codon seeds, EcoR1 restriction site in pPIC9 and 13bp sequence after the site were added to the C-terminus.

[0039] 2) Construction of expression vector

[0040] After the pPIC9 was digested by EcoR I, it was connected with the target fragment by homologous recombination under the action of In-Fusion enzyme. The ligation product was tran...

Embodiment 2

[0051] Example 2: Crystal preparation and structural analysis of Verticillium dahliae chitin deacetylase VdPDA1

[0052] 1. Screening of VdPDA1 protein crystallization conditions

[0053] 1) Primary screening of crystallization conditions

[0054] The protein was concentrated to 10 mg / mL. The hanging drop method was used to screen the protein crystallization conditions. Seven commercial crystallization kits were used for the initial screening of the crystal conditions, including Index, CrystalScreen, Crystal Screen 2 produced by Hampton Research, Wizard 1 produced by Rigak Reagents. and Wizard 2, as well as Protein Complex Suite and JCSG+Suite produced by Qiagen. A total of 480 crystallization conditions are included, which are distributed into 24-well crystal culture plates as pool liquid for use. Then take 1 μL of the target protein and 1 μL of the pool solution and mix it on the silanized coverslip. Invert the coverslip on the upper interface of the crystal culture plate...

Embodiment 3

[0063] Example 3: Antibacterial agent design method based on plant soil-borne pathogenic fungal chitin deacetylase protein structure

[0064] 1. Select the ZINC database containing about 4 million commercial compounds as the virtual screening compound library, and use Autodockvina molecular docking software to perform virtual screening of the compounds in the ZINC database for shape and electrical similarity:

[0065] 1) Shape similarity screening: Using the molecular conformation of the smallest length substrate in the complex structure of VdPDA1 and chitin oligosaccharide as a template, the three-dimensional structure of the compound was generated by the Omega program, and the ROCS program was used to calculate the molecular shape of the compound structure and the template in the database. Similarity, compounds were sorted by TanimotoCombo score to determine the top 1000 scoring compounds.

[0066] 2) Electrical similarity screening: Use the EON program to perform charge sim...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a chitin deacetylase protein crystal, which is a three-dimensional structure, and the crystal has a space P2 1 2 1 2 1 , the unit cell parameter is the amino acid sequence of the chitin deacetylase protein as shown in SEQ ID No.1. The present invention can design antibacterial agents through crystal structure analysis and structure information obtained by structural analysis, and has broad application prospects in the field of preventing and controlling plant soil-borne fungal diseases.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a chitin deacetylase protein crystal, a preparation method and an application thereof. Background technique [0002] Soil-borne pathogenic fungal diseases of plants cause crop yield reduction, or even extinction, which seriously threatens my country's agricultural production and social and economic stability. At present, there is no targeted high-efficiency green antibacterial agent. Chitin deacetylase is a key pathogenic factor for pathogenic fungi to evade plant immunity. Plant soil-borne pathogenic fungi deacetylate chitin, an important structural component of the cell wall, by secreting chitin deacetylase. modified to evade chitin-induced plant immune recognition. The lack of chitin deacetylase activity will cause pathogenic fungi to lose their pathogenicity, and there is no homologous protein in humans and plants, so the use of small molecular compounds to inhibit c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/80C12Q1/34
CPCC12N9/80C12Q1/34C12Y305/01041C07K2299/00G01N2333/98Y02A40/10
Inventor 杨青刘霖
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI