Gene GauRev2 capable of remarkably improving verticillium wilt resistance of cotton and application of gene GauRev2

A technology for Verticillium wilt and cotton, which is applied to the gene GauRev2 that significantly improves the resistance of cotton Verticillium wilt and its application field, and can solve the problems of lack of previous research and unusable breeding

Active Publication Date: 2021-08-10
NANJING AGRICULTURAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, because Australian cotton belongs to the third-level gene bank cotton species, it has not been able to be used in breeding for a long time due to the lack of necessary preliminary research.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene GauRev2 capable of remarkably improving verticillium wilt resistance of cotton and application of gene GauRev2
  • Gene GauRev2 capable of remarkably improving verticillium wilt resistance of cotton and application of gene GauRev2
  • Gene GauRev2 capable of remarkably improving verticillium wilt resistance of cotton and application of gene GauRev2

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Isolation and cloning of embodiment 1GausREV2 gene

[0044] 1. Expression analysis

[0045] The applicant screened the genes involved in resisting the infection of Verticillium dahliae by analyzing the transcriptome of TA01-7G (containing a chromosome segment of Australian cotton) after inoculation with Verticillium dahliae. A gene from the exogenous insert was obtained by screening, and the expression pattern of the gene was identified by qRT-PCR. Quantitative primers were designed in the 3'UTR region of GausREV2, GHREV2_At, GHREV2_Dt, GBREV2_At and GBREV2_Dt genes as follows:

[0046] qGausREV2-F:GAAACTTTTTGTGCAACTTG

[0047] qGausREV2-R:TCTGGAATCATTAATAATGT

[0048] qGHREV2At-F:GAAACTCTGTTTTTTTTGCA

[0049] qGHREV2At-R:GAAACTTTTTGTGCAACTTG

[0050] qGHREV2Dt-F:GAAACTGTGTTTTTTGCAAC

[0051] qGHREV2Dt-R:TCTGGAATCATTAATAATGT

[0052] qGBREV2At-F:GAAACTCTGTTTTTTTTTTGC

[0053] qGBREV2At-R: TCGGGAATCATTAATAATGT

[0054] qGHREV2Dt-F:GAAACTGTGTTTTTTGCAAC

[0055] ...

Embodiment 2

[0060] Example 2 Phylogenetic Analysis of GausREV2 Homologous Genes in Different Species

[0061] By submitting the amino acid sequence of GausREV2 (as shown in SEQ ID NO.2) to the NCBI official website, use the blastp program to obtain Australian cotton, Asian cotton, Raymond cotton, upland cotton TM-1, sea island cotton H7124, tobacco, soybean , homologous genes in maize, Brassica napus, rice, cocoa and Arabidopsis. Afterwards, MEGA software was used for multiple sequence alignment analysis, and the results were as follows: figure 2 The results of the phylogenetic tree.

Embodiment 3

[0062] Example 3 The use of virus-mediated gene silencing technology (VIGS) to study the function of GausREV2

[0063] 1. Silencing of GausREV2 gene in cotton

[0064] According to the primer design principle of VIGS, using GausREV2-VIGS-F: TTTCGGGAAAACAGTTCAGG and GausREV2-VIGS-R: AATCAACGCAATCCGAAATC primers, using the cDNA of the root of Australian cotton as a template, amplify the silent fragment and construct it on the pTRV2 vector. And transformed into Escherichia coli DH5α, after the sequencing was correct, the positive plasmid was transferred into Agrobacterium GV3101. The pTRV2 empty vector was used as a negative control, and the pTRV:CLA vector was used as a positive control. After mixing the auxiliary vector pTRV1, the cotyledon of cotton was injected with a sterile needle-free syringe. When the albino phenotype appeared in the positive control, the silencing efficiency of the GausREV2 gene in cotton was detected by fluorescent quantitative PCR.

[0065] 2. Identi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene GauRev2 capable of remarkably improving verticillium wilt resistance of cotton and application of the gene GauRev2. The gene has a nucleotide sequence as shown in SEQ ID NO. 1. According to the invention, the expression of the GausREV2 gene in cotton is inhibited through a virus-mediated gene silencing technology, and after a verticillium wilt spore suspension is inoculated, the silencing plant is more susceptible to diseases. In arabidopsis thaliana, resistance to verticillium wilt can be remarkably improved through heterologous overexpression of the GausREV2. Discovery and utilization of the GausREV2 are beneficial to cultivation of cotton varieties resistant to verticillium wilt, and the problems in cotton production are solved. The molecular mechanism of the GausREV2 on verticillium wilt resistance is deeply researched, so that the GausREV2 has important theoretical significance for breeding cotton varieties with high verticillium wilt resistance by cotton breeders.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering breeding, and in particular relates to a gene GauRev2 capable of significantly improving cotton Verticillium wilt resistance and an application thereof. Background technique [0002] Cotton Verticillium wilt is a soil-borne fungal disease caused by Verticillium dahlia. When environmental conditions are suitable, continuous cropping of cotton often results in large-scale occurrence of Verticillium wilt (Atallah and Subbarao, 2012). The pathogenic part is mainly in the vascular tissue of the plant, and once the disease occurs in cotton, it cannot be controlled; more importantly, Verticillium dahliae has strong biological adaptability, and it can survive under low temperature (10°C) and high temperature (30°C) conditions. All can grow, and under adversity conditions, they will also produce dormant structures of micro-sclerotia to avoid adverse environments (Jian Guiliang et al., 2003, Zhu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415C12N15/84A01H5/00A01H6/60A01H6/20
CPCC07K14/415C12N15/8282C12N15/8218C12N15/8205
Inventor周宝良刘富杰冯国礼
OwnerNANJING AGRICULTURAL UNIVERSITY