Gene GauRev2 capable of remarkably improving verticillium wilt resistance of cotton and application of gene GauRev2
A technology for Verticillium wilt and cotton, which is applied to the gene GauRev2 that significantly improves the resistance of cotton Verticillium wilt and its application field, and can solve the problems of lack of previous research and unusable breeding
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Isolation and cloning of embodiment 1GausREV2 gene
[0044] 1. Expression analysis
[0045] The applicant screened the genes involved in resisting the infection of Verticillium dahliae by analyzing the transcriptome of TA01-7G (containing a chromosome segment of Australian cotton) after inoculation with Verticillium dahliae. A gene from the exogenous insert was obtained by screening, and the expression pattern of the gene was identified by qRT-PCR. Quantitative primers were designed in the 3'UTR region of GausREV2, GHREV2_At, GHREV2_Dt, GBREV2_At and GBREV2_Dt genes as follows:
[0046] qGausREV2-F:GAAACTTTTTGTGCAACTTG
[0047] qGausREV2-R:TCTGGAATCATTAATAATGT
[0048] qGHREV2At-F:GAAACTCTGTTTTTTTTGCA
[0049] qGHREV2At-R:GAAACTTTTTGTGCAACTTG
[0050] qGHREV2Dt-F:GAAACTGTGTTTTTTGCAAC
[0051] qGHREV2Dt-R:TCTGGAATCATTAATAATGT
[0052] qGBREV2At-F:GAAACTCTGTTTTTTTTTTGC
[0053] qGBREV2At-R: TCGGGAATCATTAATAATGT
[0054] qGHREV2Dt-F:GAAACTGTGTTTTTTGCAAC
[0055] ...
Embodiment 2
[0060] Example 2 Phylogenetic Analysis of GausREV2 Homologous Genes in Different Species
[0061] By submitting the amino acid sequence of GausREV2 (as shown in SEQ ID NO.2) to the NCBI official website, use the blastp program to obtain Australian cotton, Asian cotton, Raymond cotton, upland cotton TM-1, sea island cotton H7124, tobacco, soybean , homologous genes in maize, Brassica napus, rice, cocoa and Arabidopsis. Afterwards, MEGA software was used for multiple sequence alignment analysis, and the results were as follows: figure 2 The results of the phylogenetic tree.
Embodiment 3
[0062] Example 3 The use of virus-mediated gene silencing technology (VIGS) to study the function of GausREV2
[0063] 1. Silencing of GausREV2 gene in cotton
[0064] According to the primer design principle of VIGS, using GausREV2-VIGS-F: TTTCGGGAAAACAGTTCAGG and GausREV2-VIGS-R: AATCAACGCAATCCGAAATC primers, using the cDNA of the root of Australian cotton as a template, amplify the silent fragment and construct it on the pTRV2 vector. And transformed into Escherichia coli DH5α, after the sequencing was correct, the positive plasmid was transferred into Agrobacterium GV3101. The pTRV2 empty vector was used as a negative control, and the pTRV:CLA vector was used as a positive control. After mixing the auxiliary vector pTRV1, the cotyledon of cotton was injected with a sterile needle-free syringe. When the albino phenotype appeared in the positive control, the silencing efficiency of the GausREV2 gene in cotton was detected by fluorescent quantitative PCR.
[0065] 2. Identi...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



