Inducible promoter from filamentous fungus aspergillus niger and application of inducible promoter
A filamentous fungus and promoter technology, applied in the field of genetic engineering, can solve problems such as interference
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Example 1 Acquisition of promoter sequence
[0033] Utilize NCBI database (http: / / www.ncbi.nlm.nih.gov / ) to obtain the upstream sequence of Aspergillus niger P450 enzyme gene, design PCR upstream and downstream primers, use Aspergillus niger ATCC1015 genome as template, carry out PCR amplification to obtain 724bp Promoter fragments such as figure 2 shown.
[0034] C7-F: AAGGCGATGAGGTTGTAATG (upstream primer)
[0035] C7-R: GGATTACGGCACAGACAC (downstream primer)
[0036] The promoter fragment was connected to the T vector, followed by sequencing, and the nucleotide sequence of the inducible promoter C7 was obtained as shown in SEQ ID NO:1.
Embodiment 2
[0037] Example 2 Construction of overexpression vector
[0038] The primer sequences required for construction are as follows:
[0039] pPZP-HindIII-F: AAGCTTCATTGTTGTCTCCTTC (upstream sequence)
[0040] pPZP-XbaI-R: TCTAGAGCCCCGACAG C (downstream sequence)
[0041] L-T of the plasmid vector was digested with NcotI and HindIII, and a 0.5 kb L fragment was obtained by gel recovery and purification. The plasmid vector pCSN44-HYG was digested with HindIII and XbaI, and a 2.4kb HYG fragment was obtained by gel recovery and purification. The plasmid vector pBlue-HYG was digested with NcotI and XbaI, and a 3.0 kb pBlue fragment was obtained by gel recovery and purification. The three fragments were ligated in vitro by using recombinase to obtain recombinant plasmid pBlue-L-HYG. Digest with SacI enzyme and XbaI enzyme, and recover the pBlue-L-HYG fragment by gel recovery. The vector C7-68J5-TT-T was digested with EcoRI and XbaI and purified by gel back to obtain a 3.24 kb fragme...
Embodiment 3
[0043] Example 3 Electric transfer of recombinant plasmids to Agrobacterium and screening
[0044](1) Preparation of Competent Agrobacterium
[0045] a. Take the Agrobacterium glycerol tube and inoculate it on the LB plate by streaking three sections, and culture at 28°C until a single colony grows;
[0046] b. Pick a single colony of Agrobacterium, inoculate in 5mL LB liquid medium, and culture at 28°C and 200rpm for about 12 hours;
[0047] c. Inoculate the above bacterial solution into 50mL LB liquid medium with an inoculum amount of 2%, culture at 28°C and shake at 200rpm for 4-6h, until the OD600 value is 0.8;
[0048] d. Transfer the cultured bacterial solution to a pre-cooled sterilized 50mL centrifuge tube in an ice bath for 30min, centrifuge at 5000rpm for 10min at 4°C, and discard the supernatant;
[0049] e. Resuspend the cells with 10 mL of pre-cooled sterile water, centrifuge at 5000 rpm for 10 min at 4 °C, and discard the supernatant;
[0050] f. Resuspend the...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


