Unlock instant, AI-driven research and patent intelligence for your innovation.

Inducible promoter from filamentous fungus aspergillus niger and application of inducible promoter

A filamentous fungus and promoter technology, applied in the field of genetic engineering, can solve problems such as interference

Pending Publication Date: 2021-11-19
TIANJIN UNIV OF SCI & TECH
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The present invention aims at the problem of interfering pigments produced in the process of steroidal C11α hydroxylation of the current industrial fungus ochra TCCC41060, and uses an inducible promoter C7 of Aspergillus niger to overexpress the ochra C11α hydroxylation gene CYP68J5 in Aspergillus niger cells (referred to as 68J5), the construction of a genetically engineered strain that efficiently catalyzes the hydroxylation of steroids is of great significance for improving the biotransformation efficiency of steroids

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Inducible promoter from filamentous fungus aspergillus niger and application of inducible promoter
  • Inducible promoter from filamentous fungus aspergillus niger and application of inducible promoter
  • Inducible promoter from filamentous fungus aspergillus niger and application of inducible promoter

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1 Acquisition of promoter sequence

[0033] Utilize NCBI database (http: / / www.ncbi.nlm.nih.gov / ) to obtain the upstream sequence of Aspergillus niger P450 enzyme gene, design PCR upstream and downstream primers, use Aspergillus niger ATCC1015 genome as template, carry out PCR amplification to obtain 724bp Promoter fragments such as figure 2 shown.

[0034] C7-F: AAGGCGATGAGGTTGTAATG (upstream primer)

[0035] C7-R: GGATTACGGCACAGACAC (downstream primer)

[0036] The promoter fragment was connected to the T vector, followed by sequencing, and the nucleotide sequence of the inducible promoter C7 was obtained as shown in SEQ ID NO:1.

Embodiment 2

[0037] Example 2 Construction of overexpression vector

[0038] The primer sequences required for construction are as follows:

[0039] pPZP-HindIII-F: AAGCTTCATTGTTGTCTCCTTC (upstream sequence)

[0040] pPZP-XbaI-R: TCTAGAGCCCCGACAG C (downstream sequence)

[0041] L-T of the plasmid vector was digested with NcotI and HindIII, and a 0.5 kb L fragment was obtained by gel recovery and purification. The plasmid vector pCSN44-HYG was digested with HindIII and XbaI, and a 2.4kb HYG fragment was obtained by gel recovery and purification. The plasmid vector pBlue-HYG was digested with NcotI and XbaI, and a 3.0 kb pBlue fragment was obtained by gel recovery and purification. The three fragments were ligated in vitro by using recombinase to obtain recombinant plasmid pBlue-L-HYG. Digest with SacI enzyme and XbaI enzyme, and recover the pBlue-L-HYG fragment by gel recovery. The vector C7-68J5-TT-T was digested with EcoRI and XbaI and purified by gel back to obtain a 3.24 kb fragme...

Embodiment 3

[0043] Example 3 Electric transfer of recombinant plasmids to Agrobacterium and screening

[0044](1) Preparation of Competent Agrobacterium

[0045] a. Take the Agrobacterium glycerol tube and inoculate it on the LB plate by streaking three sections, and culture at 28°C until a single colony grows;

[0046] b. Pick a single colony of Agrobacterium, inoculate in 5mL LB liquid medium, and culture at 28°C and 200rpm for about 12 hours;

[0047] c. Inoculate the above bacterial solution into 50mL LB liquid medium with an inoculum amount of 2%, culture at 28°C and shake at 200rpm for 4-6h, until the OD600 value is 0.8;

[0048] d. Transfer the cultured bacterial solution to a pre-cooled sterilized 50mL centrifuge tube in an ice bath for 30min, centrifuge at 5000rpm for 10min at 4°C, and discard the supernatant;

[0049] e. Resuspend the cells with 10 mL of pre-cooled sterile water, centrifuge at 5000 rpm for 10 min at 4 °C, and discard the supernatant;

[0050] f. Resuspend the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a novel inducible promoter from filamentous fungus aspergillus niger and plasmid vector construction thereof, wherein the amino acid sequence of the novel inducible promoter is as shown in SEQ ID NO:1; the promoter can induce efficient inducible expression of exogenous genes in aspergillus niger cells, such as high-level expression of P450 steroid hydroxylase genes; the high-level expression of the aspergillus ochraceus C11[alpha]-hydroxylase gene 68J5 in aspergillus niger ATCC1015 cells and the conversion efficiency of recombinant bacteria to steroid substrate 16,17[alpha]-epoxy progesterone are investigated, so the aspergillus ochraceus C11[alpha]-hydroxylase gene 68J5 can be used for constructing aspergillus niger high-efficiency gene engineering bacteria.

Description

Technical field: [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to an inducible promoter and its application. Background technique: [0002] Steroid hormones are widely used clinically. These drugs are used to treat conditions such as inflammation and allergies, as well as to treat cancer, disorders of the body's hormone production, and for birth control. The physiological and pharmacological activities of steroidal drugs depend on the introduction of functional groups at specific sites in the steroidal skeleton. The modification of the steroidal structure is by chemical synthesis or microbial transformation, or a combination of the two methods. The total chemical synthesis method has the disadvantages of complex synthesis process and difficult separation of by-products, so the key synthetic steps that are difficult to complete in the chemical synthesis method are industrially used microbial transformation reactions to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/11C12N15/80C12N1/15C12P33/06C12P33/10C12R1/685
CPCC12N9/0004C12N15/80C12P33/06C12P33/10C12N2830/002
Inventor 刘晓光郭文丽路福平
Owner TIANJIN UNIV OF SCI & TECH