Daptomycin high-yield strain and application thereof
A daptomycin, high-yield technology, applied in the field of genetic engineering, can solve the problems of low tolerance and low yield of daptomycin, achieve the effect of increasing yield, improving tolerance and utilization rate, and broad application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Embodiment 1: Construction of the pSET152CRP comprising the recombinant plasmid of CRP gene:
[0036] Blast the nucleotide sequence of the homologous gene CRP reported in Streptomyces coelicolor with the genome sequence of Streptomyces roseospora from NCBI (website: www.ncbi.nlm.nih.gov), and obtain the The target gene CRP, its size is 672bp.
[0037] Primers were designed with primer 5.0 as follows:
[0038] CRPS: ATTTCTAGAAATACCTGACCGAGCACG;
[0039] CRPA: ATTGGATCCATCGCACTGTTTTACCGT.
[0040] The total DNA of Streptomyces roseospora was extracted, and the CRP gene was amplified to obtain the target gene fragment.
[0041] Use the SanPerp Column Plasmid DNA Mini-Extraction Kit to extract the pSET152 plasmid according to the kit instructions. The resulting plasmid DNA solution was stored at -20°C or used for subsequent experiments.
[0042] Treat the pSET152 plasmid with restriction endonucleases, perform DNA agarose gel electrophoresis after digestion, and use th...
Embodiment 2
[0047] Example 2: Transfer of Recombinant Plasmids to Streptomyces roseospora by Intragenus Conjugation
[0048] Escherichia coli ET12567 containing the recombinant plasmid PSET152CRP was conjugatively transferred to Streptomyces roseospora NO.CGMCC4.7231, and a zygote containing the PSET152CRP plasmid was obtained by screening with apramycin and nalidixic acid. Plasmid vectors were used as controls.
[0049] Method for indirect conjugative transfer of Escherichia coli and Streptomyces roseospora NO.CGMCC4.7231:
[0050] Inoculate ET12567 (PUZ8002 / PSET152) and ET12567 (PUZ8002 / PSET152CRP) into LB (containing kanamycin / chloramphenicol / ampicillin) medium and culture overnight at 37°C in a shaker at 220rpm. Transfer ET12567 (PUZ8002 / PSET152) and ET12567 (PUZ8002 / PSET152CRP) to fresh LB medium (containing kanamycin / chloramphenicol / ampicillin) at a ratio of 1:100, shake at 220 rpm at 37°C Cultivate in bed until OD600 reaches 0.3-0.4. Resuspend the cells twice with the same volume ...
Embodiment 3
[0055] Embodiment 3: Recombinant bacteria fermentation process
[0056] After the constructed Streptomyces roseospora strain was cultured in R5 slant medium at 30°C for 5 days, it was transferred to a shaker flask containing 50ml of YEME liquid medium, and cultured at 30°C for 25 hours with shaking (220rpm / min). Feed capric acid as the fermentation precursor, cultivate until the end of fermentation, and select the strain with the highest yield. attached by the manual figure 1 Shown compared with existing Streptomyces roseosporus (starting bacterium), the high antibiotic production Streptomyces roseospora that makes in the present invention has higher fermentation yield, just has better daptomycin yield, fermentation Yield increased by more than 200%.
[0057] TSB liquid medium formula:
[0058] Tryptone 17g, soybean peptone 3g, D-glucose 2.5g, sodium chloride 5g, dipotassium hydrogen phosphate 2.5g, add deionized water to 1000ml, sterilize at 121°C for 30min.
[0059] R5 m...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com