Platycodon grandiflorum geranyl geranyl pyrophosphate synthase gene PgGGPPS and encoding product and application thereof
A technology based on geranyl pyrophosphate and enzyme gene, which is applied in the directions of application, genetic engineering, glycosyltransferase, etc., and can solve the problems of not being isolated and identified, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1 Cloning of Bellflower Geranylgeranylgeranyl Pyrophosphate Synthase Gene (PgGGPPS)
[0039] Cloning of PgGGPPS using forward primer: upstream primer: P1:
[0040] 5'ATGAGTATGGTAAATCTAAGCACAT 3'; downstream primer: P2: 5'
[0041]TCAATTGTCTCTATAAGCAATGTAA 3'. The full-length sequence of the gene encoding geranylgeranyl pyrophosphate synthase PgGGPPS in Platycodon grandiflora was used as a template for PCR amplification. The PCR reaction system was (50 μL): template cDNA 1 μL, primers primer-F and primer-R 2.5 μL each, high-fidelity enzyme Phusion 25 μL, and the rest of the reaction volume was supplemented with sterile double-distilled water. PCR reaction conditions: pre-denaturation at 98°C for 2min, denaturation at 98°C for 10s, annealing at 60°C for 30s, extension at 72°C for 2min, extension at 72°C for 5min after 40 cycles, and storage at 4°C. Obtain the agarose gel electrophoresis figure of platycodon geranylgeranyl pyrophosphate synthase gene PgGGPPS by ...
Embodiment 2
[0043] Example 2 Bioinformatics analysis of PgGGPPS gene
[0044] The length of the open reading frame (ORF) of the platycodon grandiflorum geranylgeranyl pyrophosphate synthase gene full-length cDNA obtained in the present invention is 1098bp, and the detailed sequence is shown in SEQ ID NO.1 in the sequence list. The PgGGPPS gene sequence was searched for nucleotide homology in the Non-redundant GenBank+EMBL+DDBJ+PDB and Non-redundant GenBank CDS translation+PDB+Swissprot+Superdate+PIR databases using the BLAST program in the NCBI database. At the amino acid level, it has high homology with GGPPS in other species, and has a typical IspA domain, such as figure 2 As shown; the protein secondary structure analysis was carried out by the online software NPS, and the secondary structure of the PgGGPPS protein was composed of α-helix, extended chain and random coil (such as image 3 shown); Transmembrane domain analysis of protein sequence was carried out by online software TMHM...
Embodiment 3
[0045] The construction of embodiment 3 PgGGPPS gene prokaryotic expression vector
[0046] Using the cDNA of the PgGGPPS gene as a template, BamHI was selected as a single restriction site, and specific upstream and downstream primers (as shown in Table 1) were designed for PCR amplification. The underlined part of the primer was the restriction site.
[0047] Table 1 specific upstream primer and downstream primer base sequence
[0048]
[0049] The PCR reaction system was (50 μL): template cDNA 1 μL, primers primer-F and primer-R 2.5 μL each, high-fidelity enzyme Phusion 25 μL, and the rest of the reaction volume was supplemented with sterile double-distilled water.
[0050] PCR reaction conditions: pre-denaturation at 98°C for 2min, denaturation at 98°C for 10s, annealing at 60°C for 30s, extension at 72°C for 2min, extension at 72°C for 5min after 40 cycles, and storage at 4°C.
[0051] The amplified product was detected by 1% agarose gel electrophoresis and recovered ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com