Platycodon grandiflorum geranyl geranyl pyrophosphate synthase gene PgGGPPS and encoding product and application thereof

A technology based on geranyl pyrophosphate and enzyme gene, which is applied in the directions of application, genetic engineering, glycosyltransferase, etc., and can solve the problems of not being isolated and identified, etc.

Active Publication Date: 2021-12-24
ANHUI UNIVERSITY OF TRADITIONAL CHINESE MEDICINE
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there is no report on bellflower geranylgeranyl diphosphate synthas...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Platycodon grandiflorum geranyl geranyl pyrophosphate synthase gene PgGGPPS and encoding product and application thereof
  • Platycodon grandiflorum geranyl geranyl pyrophosphate synthase gene PgGGPPS and encoding product and application thereof
  • Platycodon grandiflorum geranyl geranyl pyrophosphate synthase gene PgGGPPS and encoding product and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Cloning of Bellflower Geranylgeranylgeranyl Pyrophosphate Synthase Gene (PgGGPPS)

[0039] Cloning of PgGGPPS using forward primer: upstream primer: P1:

[0040] 5'ATGAGTATGGTAAATCTAAGCACAT 3'; downstream primer: P2: 5'

[0041]TCAATTGTCTCTATAAGCAATGTAA 3'. The full-length sequence of the gene encoding geranylgeranyl pyrophosphate synthase PgGGPPS in Platycodon grandiflora was used as a template for PCR amplification. The PCR reaction system was (50 μL): template cDNA 1 μL, primers primer-F and primer-R 2.5 μL each, high-fidelity enzyme Phusion 25 μL, and the rest of the reaction volume was supplemented with sterile double-distilled water. PCR reaction conditions: pre-denaturation at 98°C for 2min, denaturation at 98°C for 10s, annealing at 60°C for 30s, extension at 72°C for 2min, extension at 72°C for 5min after 40 cycles, and storage at 4°C. Obtain the agarose gel electrophoresis figure of platycodon geranylgeranyl pyrophosphate synthase gene PgGGPPS by ...

Embodiment 2

[0043] Example 2 Bioinformatics analysis of PgGGPPS gene

[0044] The length of the open reading frame (ORF) of the platycodon grandiflorum geranylgeranyl pyrophosphate synthase gene full-length cDNA obtained in the present invention is 1098bp, and the detailed sequence is shown in SEQ ID NO.1 in the sequence list. The PgGGPPS gene sequence was searched for nucleotide homology in the Non-redundant GenBank+EMBL+DDBJ+PDB and Non-redundant GenBank CDS translation+PDB+Swissprot+Superdate+PIR databases using the BLAST program in the NCBI database. At the amino acid level, it has high homology with GGPPS in other species, and has a typical IspA domain, such as figure 2 As shown; the protein secondary structure analysis was carried out by the online software NPS, and the secondary structure of the PgGGPPS protein was composed of α-helix, extended chain and random coil (such as image 3 shown); Transmembrane domain analysis of protein sequence was carried out by online software TMHM...

Embodiment 3

[0045] The construction of embodiment 3 PgGGPPS gene prokaryotic expression vector

[0046] Using the cDNA of the PgGGPPS gene as a template, BamHI was selected as a single restriction site, and specific upstream and downstream primers (as shown in Table 1) were designed for PCR amplification. The underlined part of the primer was the restriction site.

[0047] Table 1 specific upstream primer and downstream primer base sequence

[0048]

[0049] The PCR reaction system was (50 μL): template cDNA 1 μL, primers primer-F and primer-R 2.5 μL each, high-fidelity enzyme Phusion 25 μL, and the rest of the reaction volume was supplemented with sterile double-distilled water.

[0050] PCR reaction conditions: pre-denaturation at 98°C for 2min, denaturation at 98°C for 10s, annealing at 60°C for 30s, extension at 72°C for 2min, extension at 72°C for 5min after 40 cycles, and storage at 4°C.

[0051] The amplified product was detected by 1% agarose gel electrophoresis and recovered ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a Platycodon grandiflorum geranyl geranyl pyrophosphate synthase gene PgGGPPS and an encoding product and application thereof. The encoding gene (PgGGPPS) of the Platycodon grandiflorum geranyl geranyl pyrophosphate synthase is cloned from the root of Platycodon grandiflorum, and the encoding gene (PgGGPPS) can be applied to a path for preparing geranyl geranyl pyrophosphate by taking DMAPP and IPP as substrates. The technology can be used for subsequently producing a large amount of geranyl and geranyl pyrophosphate through a bacterial system, and an effective method is provided for meeting the huge market demand faced by terpenoid components. By utilizing the gene, the content of the platycodon grandiflorum terpenoids can be increased through a genetic engineering technology.

Description

technical field [0001] The invention belongs to the field of medicinal plant genetic engineering, in particular to platycodon geranylgeranyl pyrophosphate synthase gene PgGGPPS and its coded product and application. Background technique [0002] Platycodon grandiflorum (Jacq.) A.DC is the dry root of Platycodon grandiflorum (Jacq.) A.DC. It is mainly used to treat cough with excessive phlegm, chest tightness, sore throat and hoarseness, lung abscess and vomiting of pus. "Compendium of Materia Medica" explained its name: "The root of this grass is strong and straight, so it is called Platycodon grandiflorum." Platycodon grandiflorum is one of the commonly used varieties of bulk medicinal materials, which belongs to the species of "medicine and food from the same source", and has important development value in the field of medicine. [0003] Terpenoids are widely found in plants and are the most numerous compounds in plant metabolites. They have a wide range of biological act...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/54C12N9/10C12N15/70C12N1/21C12P19/44C12R1/19
CPCC12N9/1051C12Y204/01213C12N15/70C12P19/44Y02A50/30
Inventor 桂双英余函纹查良平彭华胜刘梦丽李景
Owner ANHUI UNIVERSITY OF TRADITIONAL CHINESE MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap