Basophilic Cupriavidus strain KY678 with functions of passivating heavy metal cadmium and promoting plant growth and application of basophilic Cupriavidus strain KY678

A technology to promote plant growth and copper greedy bacteria, applied in the field of microorganisms, can solve the problems of reducing heavy metal activity and environmental risks, easily destroying soil structure, soil fertility decline, etc., to achieve the effect of alleviating poison, promoting plant growth and reducing absorption

Active Publication Date: 2022-03-01
康生元(肇庆)生物科技有限公司
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It can better fix heavy metals, reduce the activity of heavy metals and environmental risks, but it is not recommended for larger areas, which is costly and labor-intensive, and is easy to damage the soil structure, resulting in a decrease in soil fertility (Huang Xin et al., 2019)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Basophilic Cupriavidus strain KY678 with functions of passivating heavy metal cadmium and promoting plant growth and application of basophilic Cupriavidus strain KY678
  • Basophilic Cupriavidus strain KY678 with functions of passivating heavy metal cadmium and promoting plant growth and application of basophilic Cupriavidus strain KY678
  • Basophilic Cupriavidus strain KY678 with functions of passivating heavy metal cadmium and promoting plant growth and application of basophilic Cupriavidus strain KY678

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: High-throughput screening of microbial strains with heavy metal resistance (cadmium (Cd)) function

[0036] 1.1 Soil sample collection

[0037] A total of more than 170 soil samples were collected from all over the country (especially in areas seriously polluted by heavy metal cadmium), including black soil, clay, red soil and other soil samples, respectively from forests, grasslands, wheat fields, rice fields, etc. These soil samples are marked with the collection place (province, city, county), collection time, and collection source (forest, grassland, wheat field, rice field, etc.).

[0038] 1.2 High-throughput enrichment screening of microbial strains resistant to heavy metals (cadmium (Cd))

[0039] Take five soil samples (0.2g for each soil sample) and mix them and place them in 50mL 250ppm cadmium liquid culture medium, shake and cultivate them at 200r / min at 30°C for 3 days, observe and record changes in the turbidity of the liquid medium ( 250ppm c...

Embodiment 2

[0050] Example 2. Verify the ability of cadmium-tolerant microorganisms to passivate heavy metal cadmium in liquid

[0051] 2.1 Microbial method preliminary verification of the ability of cadmium-tolerant microorganisms to passivate heavy metal cadmium (Cd) in liquid

[0052] It is reported in the existing literature that the ability to passivate heavy metal cadmium (Cd) of microorganisms is mainly determined by atomic absorption spectrometry to determine the content of residual heavy metals in liquid or potted plants. The advantage of this method is mainly reflected in the fact that the cadmium content of heavy metal cadmium pollutants can be directly determined and the determination results are accurate. However, if the number of microorganisms to be verified to passivate heavy metal cadmium (Cd) reaches tens or even hundreds, this method has certain defects in screening efficiency. For example, flame atomic absorption spectrometry has high requirements on instruments and c...

Embodiment 3

[0084] Example 3.KY678 strain identification-determination of 16s rDNA

[0085] 3.1 Preparation of DNA template

[0086] 3.1.1 Pick the purified single colony to the bottom of the EP tube, add 200 μL of 5% (w / v) BT-chelex 100 (distilled water configuration, sterilize at 121°C for 30 minutes); ℃ or -80 ℃, then thawed at room temperature, centrifuged at 6000r / min for 3min, and 2μL of the supernatant was taken as a template.

[0087] 3.2 16S rDNA amplification

[0088] The 16S gene was amplified according to the 16S amplification system. The 16S PCR amplification system is as follows:

[0089]

[0090]

[0091] PCR amplification program:

[0092] Step 1: 95°C, 5min;

[0093] The second step: 94°C, 1min; 55°C, 1min; 72°C, 1.5min, 35 cycles.

[0094] Step 3: 72°C, 10min; store at 4°C.

[0095] The 16S rDNA sequence (SEQ ID No.1) of strain KY678 obtained is as follows:

[0096] TGGGGCCGCATGCTTACCATGCAGTCGAACGGCAGCGCGGGCTTCGG CCTGGCGGCGAGTGGCGAACGGGTGAGTAATACATCGGAACGTG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides Cupriavidus alkaliphilus (Cupriavidus alkaliphilus) with functions of passivating heavy metal cadmium and promoting plant growth and application of the Cupriavidus alkaliphilus (Cupriavidus alkaliphilus), and relates to the technical field of microorganisms. The basophilic Cupriavidus strain KY678 is separated and screened by using a high-throughput method, and the strain has a relatively high function of passivating heavy metal cadmium, can reduce the absorption of the heavy metal cadmium by plant root systems and stem and leaf parts, and remarkably reduces the harm of the heavy metal cadmium in soil to plants; in addition, the strain also has a function of promoting plant growth, and has good popularization and application values.

Description

technical field [0001] The present invention relates to the technical field of microbes, in particular to an alkaliphilic cupricophilus bacterial strain KY678 capable of passivating heavy metal cadmium and promoting plant growth and its application. Background technique [0002] Heavy metals refer to metals or metalloid elements with a specific gravity equal to or greater than 5.0 (except selenium, Se, etc.), such as Pb, Cd, As, etc. If the intake is too high, they are all toxic to animals and plants. Metal mining and smelting, chemical industry production, heavy metal pesticides, sewage irrigation and chemical fertilizer application, and high geological background values ​​will all cause soil heavy metal pollution. Among them, non-ferrous metal mining and smelting discharge heavy metal-containing waste gas, waste water and waste residues, etc. The dissolution and diffusion of waste into the soil is the main way of heavy metal pollution. Mining and smelting activities lead ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20
CPCC12N1/20B09C1/105C02F3/34C05F11/08C05G3/00C05G3/80A01N63/20C09K17/14B09C2101/00C02F2101/20C09K2101/00Y02A40/10
Inventor康耀卫唐珏晖苑莹麦思漫
Owner康生元(肇庆)生物科技有限公司