Protein glutaminase production strain, screening method and characteristic analysis method

A glutaminase and protein technology, applied in the field of bioengineering, can solve the problems of low enzyme production capacity, protein aggregation, easy to produce bitter taste, etc., and achieve the effects of high enzyme production and rapid growth

Active Publication Date: 2022-03-08
EAST CHINA NORMAL UNIV
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But all have certain deficiencies: Excessive use of transglutaminase will cause protein aggregation; protease can hydrolyze protein into short peptides, substrate specificity is poor, and it is easy to produce bitter taste; peptide glutaminase is sensitive to high molecular weight Peptides and proteins do not play a role, and the degree of deamidation is not high
At present, the only one approved for industrial production is Chryseobacterium prionolyticum, but its enzyme production ability is low, and the enzyme activity is about 0.34U / mL 1

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein glutaminase production strain, screening method and characteristic analysis method
  • Protein glutaminase production strain, screening method and characteristic analysis method
  • Protein glutaminase production strain, screening method and characteristic analysis method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Example 1 Screening of protein-producing glutaminase strains

[0066] (1) Soil suspension enrichment culture

[0067] The screening steps are:

[0068] Add 90mL of distilled water and 20-30 glass beads into a 250mL shaker flask, and sterilize by high pressure steam at 121°C for 20min. In an ultra-clean workbench, weigh 10 g of soil sample, add it to a shaker flask filled with distilled water, shake at 30° C. and 200 rpm / min for 30 min, and prepare a 10% (w / v) soil suspension. Then place it in an ultra-clean workbench and let it stand. Take 1% (v / v) soil suspension into the enrichment medium (60 mL), shake at 30° C. and 200 rpm / min for 5 days.

[0069] The enrichment medium is: lactose 5g, yeast powder 11.7g, CBZ 1g, K 2 HPO 4 0.1g, KH 2 PO 4 0.1g, 0.1g sodium chloride, pH7.2, add distilled water to make up to 1L, and sterilize at 115°C for 20min.

[0070] (2) Plate primary screening

[0071] Dilute the enriched bacterial solution to multiple ratios, select an...

Embodiment 2

[0085] The identification of embodiment 2 protein-producing glutaminase strains

[0086] The suspected strain screened in Example 1 of the present invention was re-streaked on the LB plate to obtain a single colony, and then the color and state of the strain were observed. The colony was round, the colony was full, the edges were smooth, no nicks, and the colony was sticky. Such as image 3 shown.

[0087] Subsequent Gram staining revealed that the strain was rod-shaped, non-spore-forming, and Gram-negative.

[0088] According to the instructions of the physiological and biochemical identification tube, the first choice is to activate the strain, then prepare a bacterial suspension, inoculate it in the physiological and biochemical tube and cultivate it for 24 hours, observe the experimental phenomenon and make a record. Among them, "+" indicates that the strain is positive, and "-" indicates that the strain is negative. The identification results were different from the Ch...

Embodiment 3

[0095] Identification and Analysis of Protein Glutaminase of Example 3 Bacterial Strain A4142

[0096] Extract the total genomic DNA of bacterial strain A4142, and use this as a template to amplify the full-length DNA sequence of the protein glutaminase produced by the bacterial strain, and its primer sequence is:

[0097] SEQ ID No. 3: F-proteolyticum AACTTGCTTATGTTATTTTTTTTTAT

[0098] SEQ ID No.4: R-proteolyticum GGATGTTATCATACAAAAAAAATAAT

[0099] The PCR products were detected by 1% agarose gel electrophoresis, recovered by tapping the gel, and sent to Shanghai Sunny Company for sequencing. Obtain the gene sequence of the PG enzyme of bacterial strain A4142, i.e. SEQ ID No.5 (963bp in total in the DNA sequence), translate the sequence to obtain the PG enzyme protein sequence, shown in SEQ ID No.6, wherein there are 320 protein sequences in total Amino acids, wherein 21 amino acid signal peptides (as shown in SEQ ID No.7), 114 amino acid propeptides (as shown in SEQ ID N...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a protein glutaminase production strain, a screening method and a characteristic analysis method. The invention discloses a protein glutaminase high-yield strain, which is named as Chryseobacterium proteolyticumA4142, and is preserved in the China General Microbiological Culture Collection Center on July 10, 2020, the preservation address is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the preservation number is CGMCC (China General Microbiological Culture Collection Center) NO.20337. The invention further discloses a preparation method of the protein glutaminase high-yield strain. The bacterial strain is rod-shaped, does not produce spores, is gram negative, has a round bacterial colony, and is full in state, smooth in edge, free of notch and sticky. According to the present invention, the Chryseobacterium prion A4142 strain is subjected to fermentation culture in the culture medium, the enzyme yield is up to 2.15 U / mL, and the Chryseobacterium prion A4142 is the strain subjected to food safety certification; the invention further discloses a screening method of the novel protein glutaminase high-yield strain, and characteristic analysis is carried out on the novel protein glutaminase high-yield strain to determine that the strain is Chryseobacterium prion. The method disclosed by the invention has a good implementation prospect in the aspect of industrial production of the protein glutaminase.

Description

technical field [0001] The invention relates to the field of bioengineering, and relates to the screening (enrichment culture) of protein glutaminase production strains and the characteristic analysis of growth and metabolism. Background technique [0002] Natural proteins contain more glutamine and asparagine residues, which are cross-linked with other amino acids in the form of hydrogen bonds, resulting in a decrease in the solubility of the protein, which in turn affects the technological properties of the protein, such as emulsification, foaming, gelation, etc., thereby limiting the application of protein in food, beverage, health care products, medicine and other fields. [0003] Protein deamidation, a potentially useful modification of soybean and other glutamine-rich proteins, has attracted attention in biochemical and industrial applications. Protein modification technology can act on protein through physical, chemical and biological enzymatic methods to change its ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20C12N1/02C12N9/80C12Q1/34C12R1/01
CPCC12N1/20C12N1/02C12N9/80C12Y305/01044C12Q1/34
Inventor黄静朱锐施瑞杨婷万惠惠叶天韵金明飞张政
OwnerEAST CHINA NORMAL UNIV