Cps-i antibodies and uses thereof
A CPS-I and antibody technology, applied in the field of immunity, can solve the problems of high price, high randomness, and weak selectivity, and achieve the effect of cheap price, good accuracy, and good expression stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0102] Embodiment 1, prepare CPS-I immunogen
[0103] In this example, the immunogen is constructed by means of eukaryotic expression.
[0104] Selection of expression vector: pcDNA3.1
[0105] Expression host: mammalian expression system 293T cells
[0106] The sequence is: 219-405aa
[0107] Amino acid sequence:
[0108] KVVAVDCGIKNNVIRLLVKRGAEVHLVPWNHDFTKMEYDGILIAGGPGNPALAEPLIQNVRKILESDRKEPLFGISTGNLITGLAAGAKTYKMSMANRGQNQPVLNITNKQAFITAQNHGYALDNTLPAGWKPLFVNVNDQTNEGIMHESKPFFAVQFHPEVTPGPIDTEYLFDSFFSLIKKG
[0109] The corresponding gene sequence is:
[0110] ATGAAAGTGGTAGCTGTAGACTGTGGGATTAAAAACAATGTAATCCGCCTGCTAGTAAAGCGAGGAGCTGAAGTGCACTTAGTTCCCTGGAACCATGATTTCACCAAGATGGAGTATGATGGGATTTTGATCGCGGGAGGACCGGGGAACCCAGCTCTTGCAGAACCACTAATTCAGAATGTCAGAAAGATTTTGGAGAGTGATCGCAAGGAGCCATTGTTTGGAATCAGTACAGGAAACTTAATAACAGGATTGGCTGCTGGTGCCAAAACCTACAAGATGTCCATGGCCAACAGAGGGCAGAATCAGCCTGTTTTGAATATCACAAACAAACAGGCTTTCATTACTGCTCAGAATCATGGCTATGCCTTGGACAACACCCTCCCTGCTGGCTGGAAACCACTTTTTGTGAATGTCAACGATC...
Embodiment 2
[0120] Example 2, screening antibodies
[0121] 1. Animal immunization: mix the CPS-I antigen prepared in Example 1 with a water-soluble adjuvant, and immunize 6-8 week-old BALB / c mice by intramuscular injection. For the second immunization, the immunization dose is the same as the first time. After two times of immunization, the tail blood was taken to measure the serum titer by serial dilution by ELISA method.
[0122] 2. Potency determination:
[0123] 1) Firstly, the CPS-I immunogen was coated into the ELISA detection plate by PB buffer solution, and the dose was 200ng / well. Place it overnight at 2-8°C.
[0124] 2) Discard the coating solution, add 150 μL of blocking solution to each well, and block at 37° C. for 2 hours.
[0125] 3) Discard the blocking solution, add 100 μL of the tail blood that has been diluted in gradient, and the dilution ratios of the tail blood are: 1:2000, 1:4000, 1:8000, 1:16000, 1:32000, 1:64000, 1:128000, Three wells were repeated at each d...
Embodiment 3
[0142] Embodiment 3, antigen detection
[0143] The 12C15 antibody is used to form a detection kit for detecting human CPS-I tissue expression, including hydrogen peroxide blocking agent, primary antibody (12C15), horseradish peroxidase-labeled goat anti-mouse and goat anti-rabbit secondary antibody ( Dako), DAB substrate, DAB buffer, hematoxylin staining solution.
[0144] Specific operation:
[0145] 1) Slice the paraffin tissue with a thickness of 3 μm, and bake the slices at 65° C. for 2 hours.
[0146] 2) Carry out gradient dewaxing according to 15 min of xylene, 15 min of xylene, 5 min of absolute ethanol, 5 min of absolute ethanol, 5 min of 95% ethanol, 5 min of 80% ethanol, 5 min of 70% ethanol, and 5 min of 50% ethanol.
[0147] 3) Soak the dewaxed slices in pure water for 5 minutes.
[0148] 4) The slices were placed in ETDA repair solution with pH 9.0, and repaired under high pressure for 3 minutes.
[0149] 5) After natural cooling, soak in PBST washing solutio...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap