Unlock instant, AI-driven research and patent intelligence for your innovation.

Cps-i antibodies and uses thereof

A CPS-I and antibody technology, applied in the field of immunity, can solve the problems of high price, high randomness, and weak selectivity, and achieve the effect of cheap price, good accuracy, and good expression stability

Active Publication Date: 2022-03-22
郑州大学第三附属医院
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The antibody can have a good effect in the detection of liver cells and related cancers, but its immunogen is Anne E.Wennerberg, which was mechanically disrupted by formalin-fixed failed transplanted livers, and its method development is highly random
Developed a new CPS1 antibody suitable for pathological diagnosis, which can solve the shortcomings of the existing CPS1 antibody in clinical use such as low selectivity and high price

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cps-i antibodies and uses thereof
  • Cps-i antibodies and uses thereof
  • Cps-i antibodies and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0102] Embodiment 1, prepare CPS-I immunogen

[0103] In this example, the immunogen is constructed by means of eukaryotic expression.

[0104] Selection of expression vector: pcDNA3.1

[0105] Expression host: mammalian expression system 293T cells

[0106] The sequence is: 219-405aa

[0107] Amino acid sequence:

[0108] KVVAVDCGIKNNVIRLLVKRGAEVHLVPWNHDFTKMEYDGILIAGGPGNPALAEPLIQNVRKILESDRKEPLFGISTGNLITGLAAGAKTYKMSMANRGQNQPVLNITNKQAFITAQNHGYALDNTLPAGWKPLFVNVNDQTNEGIMHESKPFFAVQFHPEVTPGPIDTEYLFDSFFSLIKKG

[0109] The corresponding gene sequence is:

[0110] ATGAAAGTGGTAGCTGTAGACTGTGGGATTAAAAACAATGTAATCCGCCTGCTAGTAAAGCGAGGAGCTGAAGTGCACTTAGTTCCCTGGAACCATGATTTCACCAAGATGGAGTATGATGGGATTTTGATCGCGGGAGGACCGGGGAACCCAGCTCTTGCAGAACCACTAATTCAGAATGTCAGAAAGATTTTGGAGAGTGATCGCAAGGAGCCATTGTTTGGAATCAGTACAGGAAACTTAATAACAGGATTGGCTGCTGGTGCCAAAACCTACAAGATGTCCATGGCCAACAGAGGGCAGAATCAGCCTGTTTTGAATATCACAAACAAACAGGCTTTCATTACTGCTCAGAATCATGGCTATGCCTTGGACAACACCCTCCCTGCTGGCTGGAAACCACTTTTTGTGAATGTCAACGATC...

Embodiment 2

[0120] Example 2, screening antibodies

[0121] 1. Animal immunization: mix the CPS-I antigen prepared in Example 1 with a water-soluble adjuvant, and immunize 6-8 week-old BALB / c mice by intramuscular injection. For the second immunization, the immunization dose is the same as the first time. After two times of immunization, the tail blood was taken to measure the serum titer by serial dilution by ELISA method.

[0122] 2. Potency determination:

[0123] 1) Firstly, the CPS-I immunogen was coated into the ELISA detection plate by PB buffer solution, and the dose was 200ng / well. Place it overnight at 2-8°C.

[0124] 2) Discard the coating solution, add 150 μL of blocking solution to each well, and block at 37° C. for 2 hours.

[0125] 3) Discard the blocking solution, add 100 μL of the tail blood that has been diluted in gradient, and the dilution ratios of the tail blood are: 1:2000, 1:4000, 1:8000, 1:16000, 1:32000, 1:64000, 1:128000, Three wells were repeated at each d...

Embodiment 3

[0142] Embodiment 3, antigen detection

[0143] The 12C15 antibody is used to form a detection kit for detecting human CPS-I tissue expression, including hydrogen peroxide blocking agent, primary antibody (12C15), horseradish peroxidase-labeled goat anti-mouse and goat anti-rabbit secondary antibody ( Dako), DAB substrate, DAB buffer, hematoxylin staining solution.

[0144] Specific operation:

[0145] 1) Slice the paraffin tissue with a thickness of 3 μm, and bake the slices at 65° C. for 2 hours.

[0146] 2) Carry out gradient dewaxing according to 15 min of xylene, 15 min of xylene, 5 min of absolute ethanol, 5 min of absolute ethanol, 5 min of 95% ethanol, 5 min of 80% ethanol, 5 min of 70% ethanol, and 5 min of 50% ethanol.

[0147] 3) Soak the dewaxed slices in pure water for 5 minutes.

[0148] 4) The slices were placed in ETDA repair solution with pH 9.0, and repaired under high pressure for 3 minutes.

[0149] 5) After natural cooling, soak in PBST washing solutio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The present invention relates to CPS-I antibodies and uses thereof. The present invention relates to an anti-CPS-I antibody or an antigen-binding fragment thereof, said anti-CPS-I antibody comprising at least one CDR selected from the following sequences: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6. Experimental results show that the antibody disclosed by the invention can be applied to immune response aiming at CPS-I.

Description

technical field [0001] The present invention relates to the field of immunization, in particular to CPS-I antibody and application thereof. Background technique [0002] Carbamoyl phosphate synthetase I (carbamoyl phosphate synthetase I, CPS-I) exists in the liver mitochondria, and uses free ammonia as an amino donor to synthesize carbamoyl phosphate, and participates in the ornithine cycle to finally synthesize the metabolite urea. CPS-I is differentially expressed in the cancer tissues and paracancerous tissues of HCC, which is of great significance for the later evaluation of cancer tissues. At present, HepPar1 monoclonal antibody has played an important role in the detection of liver cells and tumors, including focal intestinal metaplasia in the small intestinal mucosa, stomach and esophagus. The HepPar1 antigen, the ornithine cycle enzyme of carbamoyl phosphate synthase 1 (CPS-I), localizes to mitochondria. [0003] In addition, if carbamoyl phosphate synthase 1 is ab...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/40C07K16/46C12N15/13G01N33/574G01N33/577G01N33/573
CPCC07K16/40G01N33/57438G01N33/577G01N33/573C07K2317/565C07K2317/52C07K2317/20C07K2317/24C07K2317/31G01N2333/9015
Inventor 曹静
Owner 郑州大学第三附属医院