Lyase from vibrio alginolyticus bacteriophage and application thereof
A phage and lyase technology, applied in the field of lyase, can solve problems such as biological safety doubts, and achieve the effect of wide-spectrum application and high-efficiency lysis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1 Construction of engineering bacteria containing perforin holA and endolysin lysin gene co-expression
[0037] The co-expression vectors of holA gene and lysin gene were constructed based on molecular cloning technology, including the construction of co-expression vectors pET32a-holA-lysin and pMMB207-holA-lysin.
[0038]1) Construction of pET32a-holA-lysin vector cloning: Purify phage HH109 (the same as the phage whose deposit number is CCTCC NO: M2020397 in the patent application with application number 202011154028.2), obtain high-concentration virus particles, and extract the genomic DNA of phage HH109, According to the HH109 genome information, the reading frame amplification primers of the perforin holA and endolysin lysin genes were designed, and the gene holA primer was holA-F1: GCCATGGCTGATATC GGATCC GTGAGTGAAAAGATTGTAAAAGCAG; holA-R1: AGAATTGCTTCAACGAACATAATCCCCTTTCTCCACTTAT; gene lysin primer is lysin-F1: ATAAGTGGAGAAAGGGGATTATGTTCGTTGAAGCAATTCT; ly...
Embodiment 2
[0040] Example 2: Observation of the phenotype of lysed Escherichia coli co-expressed with holA and lysin genes
[0041] This part includes the effects of co-expression of holA and lysin genes on the growth rate of Escherichia coli, changes in cell membrane permeability and phenotypes of strain morphological changes.
[0042] 1) Identification of inhibition of growth rate of Escherichia coli: Escherichia coli BL21(DE3) carrying pET32a-holA-lysin was cultured to the logarithmic growth phase, and 0.5mM IPTG was added to induce protein expression. After 8 hours, it was measured with a spectrophotometer Bacteria solution OD 600 , to draw the bacterial growth curve. Compared with the control group (BL21: pET32(+)), BL21 and Escherichia coli containing pET32a-holA-lysin without IPTG induction, the OD value of Escherichia coli carrying pET32a-holA-lysin was lower after induction with IPTG co-expression of holA and lysin can significantly inhibit the growth of Escherichia coli ( i...
Embodiment 3
[0045] Example 3: Identification and application of holA and lysin gene co-expression to lyse Vibrio alginolyticus from different sources
[0046] Vibrio alginolyticus E110: can be lysed by phage HH109, Vibrio alginolyticus E601 and HN498: cannot be lysed by phage HH109.
[0047] 1) Identification of inhibiting the growth rate of Vibrio alginolyticus: respectively culture the bacterial liquids of Vibrio alginolyticus E110, E601 and HN498 carrying pMMB207-holA-lysin to the logarithmic phase of growth, and add 0.5mM IPTG to induce protein expression, After 8 h, the OD of the bacterial solution was measured with a spectrophotometer 600 , to draw the bacterial growth curve. Compared with the control group, the OD values of Vibrio alginolyticus E110, E601 and HN498 carrying pMMB207-holA-lysin induced by IPTG were significantly lower, so the co-expression of holA and lysin inhibited the growth of heterologous Vibrio alginolyticus grow ( Figure 6 ).
[0048] 2) Pick single c...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com