Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Lyase from vibrio alginolyticus bacteriophage and application thereof

A phage and lyase technology, applied in the field of lyase, can solve problems such as biological safety doubts, and achieve the effect of wide-spectrum application and high-efficiency lysis

Pending Publication Date: 2022-05-03
HOHAI UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Bacteriophages widely exist in the environment, and they are viruses that host microorganisms such as fungi and bacteria. They have attracted widespread attention due to their high specificity and no side effects on the human body. However, as an independent living organism, phages will Phage-resistant strains produced, and biosafety has been questioned

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lyase from vibrio alginolyticus bacteriophage and application thereof
  • Lyase from vibrio alginolyticus bacteriophage and application thereof
  • Lyase from vibrio alginolyticus bacteriophage and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 Construction of engineering bacteria containing perforin holA and endolysin lysin gene co-expression

[0037] The co-expression vectors of holA gene and lysin gene were constructed based on molecular cloning technology, including the construction of co-expression vectors pET32a-holA-lysin and pMMB207-holA-lysin.

[0038]1) Construction of pET32a-holA-lysin vector cloning: Purify phage HH109 (the same as the phage whose deposit number is CCTCC NO: M2020397 in the patent application with application number 202011154028.2), obtain high-concentration virus particles, and extract the genomic DNA of phage HH109, According to the HH109 genome information, the reading frame amplification primers of the perforin holA and endolysin lysin genes were designed, and the gene holA primer was holA-F1: GCCATGGCTGATATC GGATCC GTGAGTGAAAAGATTGTAAAAGCAG; holA-R1: AGAATTGCTTCAACGAACATAATCCCCTTTCTCCACTTAT; gene lysin primer is lysin-F1: ATAAGTGGAGAAAGGGGATTATGTTCGTTGAAGCAATTCT; ly...

Embodiment 2

[0040] Example 2: Observation of the phenotype of lysed Escherichia coli co-expressed with holA and lysin genes

[0041] This part includes the effects of co-expression of holA and lysin genes on the growth rate of Escherichia coli, changes in cell membrane permeability and phenotypes of strain morphological changes.

[0042] 1) Identification of inhibition of growth rate of Escherichia coli: Escherichia coli BL21(DE3) carrying pET32a-holA-lysin was cultured to the logarithmic growth phase, and 0.5mM IPTG was added to induce protein expression. After 8 hours, it was measured with a spectrophotometer Bacteria solution OD 600 , to draw the bacterial growth curve. Compared with the control group (BL21: pET32(+)), BL21 and Escherichia coli containing pET32a-holA-lysin without IPTG induction, the OD value of Escherichia coli carrying pET32a-holA-lysin was lower after induction with IPTG co-expression of holA and lysin can significantly inhibit the growth of Escherichia coli ( i...

Embodiment 3

[0045] Example 3: Identification and application of holA and lysin gene co-expression to lyse Vibrio alginolyticus from different sources

[0046] Vibrio alginolyticus E110: can be lysed by phage HH109, ​​Vibrio alginolyticus E601 and HN498: cannot be lysed by phage HH109.

[0047] 1) Identification of inhibiting the growth rate of Vibrio alginolyticus: respectively culture the bacterial liquids of Vibrio alginolyticus E110, E601 and HN498 carrying pMMB207-holA-lysin to the logarithmic phase of growth, and add 0.5mM IPTG to induce protein expression, After 8 h, the OD of the bacterial solution was measured with a spectrophotometer 600 , to draw the bacterial growth curve. Compared with the control group, the OD values ​​of Vibrio alginolyticus E110, E601 and HN498 carrying pMMB207-holA-lysin induced by IPTG were significantly lower, so the co-expression of holA and lysin inhibited the growth of heterologous Vibrio alginolyticus grow ( Figure 6 ).

[0048] 2) Pick single c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a co-expression vector of lyase genes holA and lysin of bacteriophage, a recombinant strain of the co-expression vector, a bacteriophage co-expression lyase holA-lysin as well as a preparation method and application of the bacteriophage co-expression lyase holA-lysin. The lyase genes holA and lysin of bacteriophage HH109 are obtained through PCR (Polymerase Chain Reaction) amplification and the like, cloned to an expression system and transferred into a target strain to obtain recombinant bacteria. The recombinant bacterium induces expression of a lyase gene under IPTG, so that efficient splitting of bacteria such as vibrio alginolyticus and escherichia coli is realized, the splitting action has no selectivity, and the broad-spectrum application range is shown. The lyase of the bacteriophage HH109 has potential application value in prevention and treatment of vibrio infection such as vibrio alginolyticus and the like.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a lyase derived from a phage of Vibrio alginolyticus and its application. Background technique [0002] Vibrio alginolyticus is an important opportunistic pathogen in aquaculture, which has caused great harm to the mariculture industry. In addition, the Vibrio can also cause some human diseases, such as infection of facial features and gastrointestinal tract, otitis media and food poisoning. In recent years, with the rapid transformation of the aquaculture model from extensive to high-density intensification, it has led to frequent occurrence of diseases. The use of traditional treatment methods such as antibiotics and chemical disinfectants has caused many problems, such as bacterial resistance, safety issues caused by the spread of pathogenic bacteria, micro-ecological imbalances in the aquaculture water environment, and damage to the human living environment. These p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N1/21C12N15/56C12N15/55A01N63/50A01P1/00C12R1/19
CPCC12N15/70C12N9/2462C12N9/14C12Y302/01017A01N63/50
Inventor 赵哲李席席喻飞张策史燕魏富成吴颖
Owner HOHAI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com