Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Swine red cell body PCR detecting method

A porcine epierythrozoon and detection method technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve problems such as inability to amplify, reduce the false positive rate, eliminate the interference and cost of bacteria and impurity particles high effect

Inactive Publication Date: 2006-10-25
ZHEJIANG UNIV
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Messick et al. (1999) designed and synthesized Eperythroporcium porcine species-specific primers ES-f1, ES-f2, ES-r1, and ES-r2 based on the sequence data of the 16S rRNA gene of the Illinois strain of Eperythrozoon porcine. The gene fragments of 16S rRNA of Eperythrozoon porcine were selectively amplified, but the gene fragments of several closely related mycoplasma could not be amplified

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Swine red cell body PCR detecting method
  • Swine red cell body PCR detecting method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] 1. Sample collection: Strictly aseptically collect blood samples from suspicious pigs of no less than 500 μl, and store them at 4°C or frozen;

[0030] 2. DNA extraction from the tested sample: take 200 μl sterile anticoagulated blood, add 100 μl Trizol reagent, mix thoroughly, add an equal volume of Tris saturated phenol / chloroform mixture for extraction, and precipitate the supernatant with 2 times the volume of absolute ethanol After 2 hours, wash with 70% ethanol and dry, dissolve the precipitate with 10-20 μl TE buffer, and store at 4°C for later use;

[0031] 3. Set up the PCR detection kit, which includes:

[0032] (1) PCR reagent tube: the reagent tube contains 10×buffer, dNTP, primer 1 and primer 2, MgCl 2 , wherein primer 1 and primer 2 are DNA fragments synthesized by a DNA synthesizer according to the following base sequences:

[0033] Primer 15'>CGAGCATTTATCCGGATTTATTG<3'

[0034] Primer 25'>ACATGCTCCACCACTTGTTCAG<3'

[0035] (2) Positive control: This ...

Embodiment 2

[0043] The method is basically the same as that in Example 1. Pig blood samples are randomly collected aseptically, DNA is extracted, and PCR amplification is performed. For the results, see figure 2 , where 1 is the positive control, 2 is the negative control, 4, 5, 12, 14, 18 are negative for the tested samples, 3, 6, 7, 8, 9, 10, 11, 13, 15, 16, 17 are the tested samples The test sample was positive. The positive rate was 68.75%.

[0044]Without further elaboration, it is believed that one skilled in the art can, using the preceding disclosure, utilize the present invention to its fullest extent. Accordingly, the foregoing embodiments should be understood as illustrative only, and not limiting the scope of the invention in any way.

[0045] Sequences involved in the present invention

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides the method checking the pig adding red cell body PCR, the used reagent includes the PCR checking reagent box, the positive comparison containing the aiming gene segment recombining matter grain, the negative comparison, the Tap enzyme, the GoldView DNA dye, the cushioning liquid, the testing goal of the checked sample can be reached using the DNA distilling, PCR enlarging and adding and enlarging and adding outcome. The method provided by the invention can test the adding red cell body of the checked sample quickly and truly, so it can be used to the survey of the molecule epidemiology of the pig adding red cell body illness. The templet DNA has many merits such as the easy handling, the low cost, removing the jam of the bacilli and the impurity during the checking by the lens, improving the diagnosing nicety greatly and depressing the percentage of the fake masculine.

Description

technical field [0001] The invention relates to biotechnology, in particular to a PCR detection method for porcine eperythrozoon. Background technique [0002] Eperythrozoonosis is a zoonotic disease caused by Eperythrozoon parasitizing on the surface of red blood cells, plasma and bone marrow of humans or various animals. In the past, Eperythrozoa was classified as Rickettsia internationally, but in recent years, according to the 16S rRNA gene sequence analysis, Eperythrozoa is closer to Mycoplasma in classification. Eperythrozoon suis (E. suis) is a pathogen parasitic on the surface of pig red blood cells or free in plasma, which can cause weakness and anemia in newborn piglets and weaned piglets, slow growth in fattening pigs, reproductive disorders in sows, and conception rate Syndrome symptoms such as low blood pressure, no estrus, miscarriage and stillbirth seriously threaten the development of animal husbandry and human health. At present, it has caused huge economi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 杜爱芳侯玉慧赵现锋
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com