Swine red cell body PCR detecting method
A porcine epierythrozoon and detection method technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve problems such as inability to amplify, reduce the false positive rate, eliminate the interference and cost of bacteria and impurity particles high effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] 1. Sample collection: Strictly aseptically collect blood samples from suspicious pigs of no less than 500 μl, and store them at 4°C or frozen;
[0030] 2. DNA extraction from the tested sample: take 200 μl sterile anticoagulated blood, add 100 μl Trizol reagent, mix thoroughly, add an equal volume of Tris saturated phenol / chloroform mixture for extraction, and precipitate the supernatant with 2 times the volume of absolute ethanol After 2 hours, wash with 70% ethanol and dry, dissolve the precipitate with 10-20 μl TE buffer, and store at 4°C for later use;
[0031] 3. Set up the PCR detection kit, which includes:
[0032] (1) PCR reagent tube: the reagent tube contains 10×buffer, dNTP, primer 1 and primer 2, MgCl 2 , wherein primer 1 and primer 2 are DNA fragments synthesized by a DNA synthesizer according to the following base sequences:
[0033] Primer 15'>CGAGCATTTATCCGGATTTATTG<3'
[0034] Primer 25'>ACATGCTCCACCACTTGTTCAG<3'
[0035] (2) Positive control: This ...
Embodiment 2
[0043] The method is basically the same as that in Example 1. Pig blood samples are randomly collected aseptically, DNA is extracted, and PCR amplification is performed. For the results, see figure 2 , where 1 is the positive control, 2 is the negative control, 4, 5, 12, 14, 18 are negative for the tested samples, 3, 6, 7, 8, 9, 10, 11, 13, 15, 16, 17 are the tested samples The test sample was positive. The positive rate was 68.75%.
[0044]Without further elaboration, it is believed that one skilled in the art can, using the preceding disclosure, utilize the present invention to its fullest extent. Accordingly, the foregoing embodiments should be understood as illustrative only, and not limiting the scope of the invention in any way.
[0045] Sequences involved in the present invention
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 