Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for producing human thymosin alphal utilizing transgenic tomato

A technology of thymosin and human thymus, which is applied in the fields of biochemical equipment and methods, genetic engineering, plant genetic improvement, etc., can solve the problems of antigenicity of impurities, difficult to be widely used, and small clinical efficacy, so as to save transportation, The effect of avoiding cross infection and reducing production costs

Inactive Publication Date: 2007-01-10
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI +1
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The total market demand for thymosin in my country is about 40 million mg per year. At present, the main production method in China is to extract thymosin from animals, and the output is limited by the source of thymosin in animals. The product contains only about 1% of active thymosin α1, and the clinical efficacy is very small. Moreover, the impurities in the product are antigenic and have many side effects, so European and American countries have proposed not to use it in recent years
Another production method of Tα1 is chemical synthesis. Although these products have high purity, they are expensive and difficult to be widely used.
There is currently a lack of an inexpensive product with a high content of active thymosin α1 in the market

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing human thymosin alphal utilizing transgenic tomato
  • Method for producing human thymosin alphal utilizing transgenic tomato
  • Method for producing human thymosin alphal utilizing transgenic tomato

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Embodiment 1 Artificial synthesis of human Tα1 gene

[0031] According to the plant preference codon provided by Murray E.E. et al. (see Table 1), the nucleotide sequence of the human Tα1 gene reported by William et al. (1986) was modified, and a restriction enzyme site was designed upstream of the Tα1 gene BamH I, the enterokinase recognition site GATGA TGATGATAAG and BglII, Xho I and Sac I were designed downstream. Then divide the dsDNA into 5 fragments and synthesize them separately:

[0032] ①5'G AGCTCGAGTT AAGATCTCTT ATCATCATCA TCGTTCTCAG CCTCCTCAAC3'(51b);

[0033] ②5'AACCTCCTTCTTCTCCTTAA GATCCTTAGT AGTAATCTCA GAAGAAGTATCAACAGCAGC 3'(60b);

[0034] ③5'ATCAGACATT GTGGATCC 3'(18b);

[0035] ④ 3'C TCGAGCTCAA TTCTAGAGAA TAGTAGTAGT AGCAAGAGTC GGAGGAGTTGTTGGAGGAAG AAGAGGAATT 5'(71b);

[0036] ⑤ 3' CTAGGAATCA TCATTAGAGT CTTTCTCATA GTTGTCGTCG TAGTCTGTAACACCTAGG 5' (58b).

[0037] serial number

amino acid

a

serial number

amino acid

a

...

Embodiment 2

[0074] Example 2 Construction of plant expression vector pBI121Tα1④

[0075] When the Tα1 gene was synthesized, the BamHI site was designed on the left side, and the enterokinase recognition site GATGATGATG ATAAG and BglII and XhoI recognition sequences were designed on the right side. BamHI and BglII are isocaudiners, they recognize different nucleotide sequences, but produce the same sticky ends, and these two sticky ends can no longer be recognized by these two enzymes after ligation, so we can use isocaudiners Gene concatenation. After concatenation, adjacent genes are separated by enterokinase sites, and after the concatenated thymosin protein is eaten, it will be decomposed into monomeric thymosin protein in the intestine through the action of enterokinase to play a role.

[0076] The construction process of the plant expression vector pBI121 Tα1④ is as follows: Figure 4 shown. First, the Tα1 gene was excised from the plasmid pBSTα1 with BamHI and SacI, and cloned in...

Embodiment 3

[0078] Example 3 Transformation of plant expression vector into Agrobacterium tumefaciens

[0079] 1. Preparation of Agrobacterium Competent Cells:

[0080] 1) Pick a single colony of Agrobacterium strain LBA4404 and inoculate it in 5 ml of YEB liquid medium (containing 100 μg / ml streptomycin), and cultivate overnight at 28° C. and 250 rpm;

[0081] 2) Take 2ml of the culture and transfer it into 50ml of YEB liquid medium, and continue to cultivate until the OD value is about 0.6;

[0082] 3) Transfer the bacterial solution to a sterile centrifuge tube, bathe in ice for 30 minutes, and centrifuge at 5000rpm for 5 minutes;

[0083] 4) with 1.7ml 20mM sterile CaCl 2 Resuspend the bacteria, add 300 μl sterile glycerol, mix well, dispense 200 μl per tube into sterile 1.5ml microcentrifuge tubes, and store at -70°C for later use.

[0084] 2. Transformation of Agrobacterium tumefaciens:

[0085] 1) Add 2 μg of recombinant plasmid DNA to 200 μl LBA4404 competent cells, bathe in i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method to produce human thymosin alpha 1 that uses transgene tomato as bio-reactor. It optimizes the nucleotide sequence of human thymosin alpha 1 according to plant preference codon. Compounding the gene and making it connect end to end to form tetrad, then, the plant expression transforming tomato expressed by thymosin alpha 1 cascading gene that is driven by cauliflower 35s promoter would be constructed. The thymosin alpha 1 would have important effect in vivo that could promote T cell function and the producing of special antibody and cell element. It could cure autoimmune diseases like lupus erythematosus, chronicity hepatitis B, etc. It could be also used as assistant medicine for curing cancer and tumor. The fruit containing thymosin alpha 1 could enhance human body immunity.

Description

technical field [0001] The invention relates to a method for producing human thymosin α1 by transgenic tomato. Background technique [0002] Thymosin α1 (Thymosin-α1, Tα1) is a polypeptide with strong immune activity secreted by the thymus, the central immune organ of the human body. It consists of 28 amino acid residues, is rich in acidic amino acids, and is heat-stable at 80°C. The PI value of Tα1 is 4.2, and the theoretical molecular weight is 3.108kDa. It has no high-level spatial structure, no disulfide bond and glycosylation modification, and the only modification is N-terminal acetylation. Tα1 plays an important role in the body. It can promote the function of T cells, promote the production of specific antibodies and cytokines, and strengthen the immune system. Clinically, purified Tα1 can treat immunodeficiency diseases, such as lupus erythematosus, chronic hepatitis B, hepatitis C, etc. It can also be used as an auxiliary drug for the treatment of tumors and cance...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/82
Inventor 郭三堆曹慧颖
Owner THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More