DNA polymerase having ability to reduce innate selective discrimination against fluorescent dye-labeled dideoxynucleotides

a technology of dideoxynucleotide and dna polymerase, which is applied in the field of dna polymerase having ability to reduce the innate selective discrimination of fluorescent dye-labeled dideoxynucleotides, can solve the problems of many undesirable, low processivity, and generation of erroneous or misleading band patterns of radioactivity in the sequencing gel, so as to reduce the innate selective discrimination, and increase the rate of incorpor

Inactive Publication Date: 2005-04-28
HONG GUOFAN +1
View PDF7 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0028] This invention addresses the above-described problems associated with mesophilic bacillus DNA polymerases by providing novel DNA polymerases which, during direct DNA sequencing, reduce the innate selective discrimination against the incorporation of fluorescent dye-labeled ddCTP and fluorescent dye-labeled ddATP, without increasing the rate of incorporation of the other two dye-labeled ddNTP terminators (ddTTP and ddGTP) excessively. In particular, this invention provides a novel genetic modification of the amino acid sequence of a highly processive DNA polymerase (such as isolated from Bacillus stearothermophilus, Bacillus caldotenax or Bacillus caldolyticus) that, unmodified, selectively discriminates against incorporation of fluorescent dye-labeled dideoxynucleotide terminators ddATP and ddCTP (but does not discriminate against incorporation of fluorescent dye-labeled dideoxynucleotide terminators ddTTP and ddGTP). The modification results in a reduction of the innate selective discrimination against incorporation of fluorescent dye-labeled dideoxynucleotide terminators ddATP and ddCTP, such that all four of the ddNTP terminators are effectively incorporated into the DNA primer elongated by the DNA polymerase. Thus, the modified DNA polymerase of this invention is effective in reducing the innate selective discrimination against incorporation of fluorescent dye-labeled dideoxynucleotide terminators ddATP and ddCTP characteristic of the DNA polymerase in its unmodified state.
[0038] The inventors found that DNA polymerases isolated from strains of Bacillus stearothermophilus and Bacillus caldotenax possess the same amino acids at certain specific positions in their amino acid sequence. For example, they all have leucine-glutamate-glutamate at positions corresponding to positions 342-344 and phenylalanine at a position corresponding to position 422 of the amino acid sequence of the DNA polymerase isolated from No 320 strain of Bacillus stearothermophilus. The inventors further discovered that the most optimal modification to solve the problem of selective discrimination in direct fluorescent DNA sequencing for these DNA polymerases is to modify the four amino acids of the natural DNA polymerases referenced above in such a form that threonine-proline-leucine substitute respectively for leucine-glutamate-glutamate at positions 342-344 and tyrosine substitutes for phenylalanine at position 422 in their amino acid sequences. Accordingly, the nucleotide sequence encoding the natural forms of the DNA polymerases are modified at positions 1024-1032 from CTCGAAGAG to ACCCCACTG and at position 1265 from T to A to encode for the DNA polymerases having the desired properties. The combined effects of these amino acid modifications reduce the selective discrimination against incorporation of fluorescent dye-labeled ddCTP and dye-labeled ddATP of the naturally-occurring mesophilic bacillus DNA polymerases during enzymatic reaction for direct automated fluorescent DNA sequencing.
[0043] The invention also provides a DNA construct comprising at least one of the above-described DNA polymerase sequences and a vector (such as a cloning vector or an expression vector), for introducing the DNA construct into eucaryotic or procaryotic host cells (such as an E. coli host cell). In addition, the invention further provides a host cell stably transformed with the DNA construct in a manner allowing production of the peptide encoded by the DNA segment in the construct.

Problems solved by technology

A DNA polymerase with a low processivity and a low elongation rate will cause many undesirable noise background bands of radioactivity due to the presence of DNA strands which are formed with improper lengths and improper terminations.
However, even when a DNA polymerase has been endowed with all the essential properties listed above, it may still generate erroneous or misleading band patterns of radioactivity in the sequencing gel.
These artifactual patterns do not faithfully reflect the true nucleotide sequence in the template being sequenced.
They may be caused by premature termination of the elongating strands due to the presence of secondary structures formed along the template, such as “hairpins” in the regions that contain palindromic sequences or that are rich in G and C bases (3); or, they may occur as a result of inadequate “proof-reading” function of the DNA polymerase that will allow the removal of misincorporated nucleotides at the 3′ end of an elongating strand.
However, when this Bst enzyme is used for automated fluorescent DNA sequencing, only partially satisfactory results have been obtained with fluorescent dye-labeled primers (see 12 and EG Bulletin 1771 of Bio-Rad Laboratories), and even less satisfactory results are obtained with fluorescent dye-labeled ddNTP terminators.
Even when fluorescent dye-labeled primers are used, a significant number of mismatched ddNTPs are incorporated onto the 3′ end of the extending nucleotides in the enzymatic reaction, thus generating erroneous sequencing data (see Bio-Rad EG Bulletin 1771).
Another disadvantage of the Bst DNA polymerase currently known in the art is its lack of 3′-5′ exonuclease activity (5), and specifically, proof-reading 3′-5′ exonuclease activity.
However, even if a DNA polymerase exhibits 3′-5′ exonuclease activity in vitro, it is often the case that the polymerase will not adequately “proof-read”.
Thus, the polymerase will not be capable of removing mismatched nucleotides from a newly formed DNA strand as efficiently as those nucleotides correctly matched with the nucleotides of the template.
Consequently, even where the DNA polymerase has 3′-5′ exonuclease activity, it does not perform any useful proof-reading function during DNA polymerization.
However, due to the existence of an undesirable 5′-3′ exonuclease activity and a 3′-5′ exonuclease activity of unknown characteristics, the latter product is not recommended by the company for DNA sequencing (6).
The disadvantage in the dye primer technology is that the primer for each template to be sequenced must be labeled with four different fluorescent dyes and that the enzymatic reaction must be performed in four separate test tubes each containing only one of the ddNTPs, namely ddATP, ddCTP, ddGTP or ddTTP, as in the classic Sanger radioisotope method.
However, there are certain difficulties to overcome before an enzymatic reaction system suitable for a radioisotope technique or suitable for a dye primer technique can be adapted for a dye terminator technology.
These molecular alterations may interfere with the process of incorporation of the dye-labeled ddNTPs as chain terminators by the DNA polymerase to the 3′ end of an extending DNA strand in terms of lowering the rate of incorporation, lowering the processivity of the enzyme for this new substrate, reducing the enzyme-terminator binding specificity and changing the enzyme-terminator binding kinetics.
But neither can be used for fluorescent dye-labeled terminator DNA sequencing technologies.
However, a disadvantage of the DNA polymerases of these strains is that during DNA sequencing they all exhibit a high degree of selective discrimination against incorporation of certain particular members of fluorescent dye-labeled ddNTPs, namely the fluorescent dye-labeled ddCTP and fluorescent dye-labeled ddATP, as terminators onto the 3′ end of the extending DNA fragments during enzymatic reaction.
Such selective discrimination is apparently sequence-related, and cannot be corrected or compensated by mere adjustment of the concentrations of the dNTPs.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA polymerase having ability to reduce innate selective discrimination against fluorescent dye-labeled dideoxynucleotides
  • DNA polymerase having ability to reduce innate selective discrimination against fluorescent dye-labeled dideoxynucleotides
  • DNA polymerase having ability to reduce innate selective discrimination against fluorescent dye-labeled dideoxynucleotides

Examples

Experimental program
Comparison scheme
Effect test

example 1

Screening for Bst Polymerases

[0106] This invention also involves a method to measure the proof-reading 3′-5′ exonuclease activity of purified DNA polymerases. The method is useful to screen a large number of bacterial strains, such as Bacillus stearothermophilus and other mesophilic bacterial strains, to select a strain which produces a DNA polymerase with a high proof-reading 3′-5′ exonuclease activity. For instance, the method to test the proof-reading 3′-5′ exonuclease activity of DNA polymerase was carried out as follows.

[0107] A DNA primer and two DNA templates with following sequences were synthesized chemically, using a DNA synthesizer.

17-base primer   5′ CATTTTGCTGCCGGTCA 3′(SEQ ID NO: 5)           1 mg / mlTemplate (a)3′------GTAAAACGACGGCCAGTCTT------5′(SEQ ID NO: 6)                     10 mg / mlTemplate (b) 3′-----GTAAAACGACGGCCAGTCGG-----5′(SEQ ID NO: 7)                     10 mg / ml

[0108] To produce the radiolabeled primer, 1 μl (1 μg) of primer, 5 μl (50 μg) of templat...

example 2

Mutation of the Gene for Naturally-Occurring Bst DNA Polymerase Having Proofreading 3′-5′ Exonuclease Activity

[0121] The DNA fragment LF containing the gene initially isolated from the wild Bst 320 has the following sequence (see SEQ ID NO:1):

[0122] DNA Sequence (Isolated / Purified):

GCCGAAGGGG AGAAACCGCT TGAGGAGATG GAGTTTGCCATCGTTGACGT CATTACCGAA GAGATGCTTG CCGACAAGGCAGCGCTTGTC GTTGAGGTGA TGGAAGAAAA CTACCACGATGCCCCGATTG TCGGAATCGC ACTAGTGAAC GAGCATGGGCGATTTTTTAT GCGCCCGGAG ACCGCGCTGG CTGATTCGCAATTTTTAGCA TGGCTTGCCG ATGAAACGAA GAAAAAAAGCATGTTTGACG CCAAGCGGGC AGTCGTTGCC TTAAAGTGGAAAGGAATTGA GCTTCGCGGC GTCGCCTTTG ATTTATTGCTCGCTGCCTAT TTGCTCAATC CGGCTCAAGA TGCCGGCGATATCGCTGCGG TGGCGAAAAT GAAACAATAT GAAGCGGTGCGGTCGGATGA AGCGGTCTAT GGCAAAGGCG TCAAGCGGTCGCTGCCGGAC GAACAGACGC TTGCTGAGCA TCTCGTTCGCAAAGCGGCAG CCATTTGGGC GCTTGAGCAG CCGTTTATGGACGATTTGCG GAACAACGAA CAAGATCAAT TATTAACGAAGCTTGAGCAC GCGCTGGCGG CGATTTTGGC TGAAATGGAATTCACTGGGG TGAACGTGGA TACAAAGCGG CTTGAACAGATGGGTTCGGA GCTCGCCGAA ...

example 3

Cloning and Expression of the Modified Bst DNA Polymerase Having Both Ability to Reduce Selective ddNTP Discrimination and Proofreading 3′-5′ Exonuclease Activity

[0134] The plasmid pUC119 / LF-M was prepared from the strain of Escherichia coli JM109 containing the mutated DNA. The mutated DNA fragment (LF-M) containing the mutated gene for the Bst polymerase was recombined back into the expression vector pYZ23. The constructed plasmid pYZ23 / LF-M was then transformed into Escherichia coli JF1125. The mutation was further confirmed by double-stranded dideoxy DNA sequencing of isolated plasmid.

[0135] The strain of Escherichia coli JF1125 containing pYZ23 / LF-M was inoculated into LB culture containing 100 μg / ml ampicillin, and was incubated overnight at 30° C. The overnight culture was inoculated into a large volume of fresh culture, and was incubated at 30° C. until the OD600 of the culture reached 0.7. The culture was then heated at 41° C. for 3 hours for induction. The SDS-PAGE analy...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
temperatureaaaaaaaaaa
temperatureaaaaaaaaaa
temperatureaaaaaaaaaa
Login to View More

Abstract

The invention relates to genetical modification of DNA polymerase to reduce its innate selective sequence-related discrimination against incorporation of fluorescent dye-labeled ddCTP and ddATP in the enzymatic reaction for preparation of samples for automated florescent dye-labeled terminator DNA sequencing. The modified DNA polymerases are more resistant to heat inactivation and are more effective in dideoxynucleotide incorporation than current DNA polymerases.

Description

[0001] This application is a continuation-in-part application of Ser. No. 08 / 544,643 (now U.S. Pat. No. 5,747,298), filed Oct. 18, 1995, and Ser. No. 08 / 642,684, filed May 3, 1996, and the entire contents of both applications are incorporated herein by reference.BACKGROUND OF THE INVENTION [0002] The genetic material of all known living organisms is deoxyribonucleic acid (DNA), except in certain viruses whose genetic material may be ribonucleic acid (RNA). DNA consists of a chain of individual deoxynucleotides chemically linked in specific sequences. Each deoxynucleotide contains one of the four nitrogenous bases which may be adenine (A), cytosine (C), guanine (G) or thymine (T), and a deoxyribose, which is a pentose, with a hydroxyl group attached to its 3′ position and a phosphate group attached to its 5′ position. The contiguous deoxynucleotides that form the DNA chain are connected to each other by a phosphodiester bond linking the 5′ position of one pentose ring to the 3′ posit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12N1/21C12N9/12C12Q1/68
CPCC12N9/1252C12Q1/6869C12Q2563/107C12Q2535/101C12Q2521/101
InventorHONG, GUOFANHUANG, WEI-HUA
OwnerHONG GUOFAN